Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31781

Hs6st1 heparan sulfate 6-O-sulfotransferase 1 ( MGI:1354958)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31781 EMAGE:31781 EMAGE:31781 EMAGE:31781 EMAGE:31781
euxassay_006185_01 euxassay_006185_02 euxassay_006185_03 euxassay_006185_04 euxassay_006185_05
EMAGE:31781 EMAGE:31781 EMAGE:31781 EMAGE:31781 EMAGE:31781
euxassay_006185_06 euxassay_006185_07 euxassay_006185_08 euxassay_006185_09 euxassay_006185_10
EMAGE:31781 EMAGE:31781 EMAGE:31781 EMAGE:31781 EMAGE:31781
euxassay_006185_11 euxassay_006185_12 euxassay_006185_13 euxassay_006185_14 euxassay_006185_15
EMAGE:31781 EMAGE:31781 EMAGE:31781 EMAGE:31781 EMAGE:31781
euxassay_006185_16 euxassay_006185_17 euxassay_006185_18 euxassay_006185_19 euxassay_006185_20
EMAGE:31781 EMAGE:31781
euxassay_006185_21 euxassay_006185_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
utricle
strong strong
regionalstrong expression: see section 04 05 06 07 16 17 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 15 16 17
spinal cord
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13
rectum
strong strong
regionalstrong expression: see section 12 13
left lung
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 17 18 19 20
lower jaw molar
strong strong
regionalstrong expression: see section 07 08 18 19
vagus x ganglion
strong strong
regionalstrong expression: see section 06 07 15 16
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 15 16 17 18 19 20 21 22
leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 17 18 19 20 21 22
thymus primordium
strong strong
regionalstrong expression: see section 09 10 11 12 13
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21
arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 18 19 20 21 22
vibrissa
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 20 21 22
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19
esophagus epithelium
strong strong
regionalstrong expression: see section 10 11
tongue epithelium
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17
urethra of male
strong strong
regionalstrong expression: see section 13 14 15 16
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 15
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 21 22
retina
strong strong
regionalstrong expression: see section 01 02 03 22
dorsal root ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 16 17 18
pharynx epithelium
strong strong
regionalstrong expression: see section 10 11 12 13
lower jaw incisor
strong strong
regionalstrong expression: see section 12 13 14 15 16 17
oral epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
seminiferous cord
strong strong
regionalstrong expression: see section 02 03 04 05 06 16 17
ureter
strong strong
regionalstrong expression: see section 06
cochlea
strong strong
regionalstrong expression: see section 06 07 08 15 16
bladder
strong strong
regionalstrong expression: see section 12 13 14
pancreas
strong strong
regionalstrong expression: see section 07 08 09
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22
upper jaw molar
strong strong
regionalstrong expression: see section 07 08 18 19
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06
kidney pelvis
strong strong
regionalstrong expression: see section 05 14
central nervous system ganglion
strong strong
regionalstrong expression: see section 02
neural retina
strong strong
regionalstrong expression: see section 03 04
right lung
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 20
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08
kidney calyx
strong strong
regionalstrong expression: see section 03 04 05 06 07 12 13 14 15
brain
strong strong
regionalstrong expression: see section 01 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
anterior naris epithelium
strong strong
regionalstrong expression: see section 14 15 16 17
midgut
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03
thyroid gland
strong strong
regionalstrong expression: see section 09 10 13 14
external naris epithelium
strong strong
regionalstrong expression: see section 13 14 17 18
vomeronasal organ
strong strong
regionalstrong expression: see section 13 15 16 17
liver
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
upper jaw incisor
strong strong
regionalstrong expression: see section 13 14 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T502
Entity Detected:Hs6st1, heparan sulfate 6-O-sulfotransferase 1 ( MGI:1354958)
Sequence:sense strand is shown

>T502
TCTCGAGNCTGTTGGCCTACTGCGACTGTACAGCGTGGGGCCACGTGGAAGACCTCCTTGCACATGTGTG
ACGGGCGCACACCGACCCCAGAGGAGCTGCCGCCCTGCTACGAGGGCACAGACTGGTCGGGCTGCACGTT
GCAGGAGTTCATGGATTGCCCCTATAACCTGGCTAACAACCGGCAGGTGCGCATGCTGGCCGACCTCAGC
CTGGTGGGCTGCTACAACCTATCTTTCATCCCCGAGAGCAAGCGGGCCCAGTTGCTGCTGGAGAGCGCCA
AGAAGAACCTGCGAGGCATGGCCTTCTTCGGCCTCACTGAGTTCCAGCGCAAGACGCAGTACCTATTTGA
GCGGACGTTCAACCTCAAGTTCATCCGGCCATTCATGCAATACAACAGCACGCGGGCGGGCGGTGTGGAG
GTGGATGAGGACACTATCCGCCACATCGAGGAGCTCAACGACCTGGACATGCAGCTGTATGACTATGCCA
AGGACCTCTTTCAGCAGCGTTACCAGTACAAGAGACAGCTGGAGCGCAGGGAACAGCGCCTGCGCAATCG
CGA
Notes:The probe template was PCR amplified from IMAGE:1481682 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1481682 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006185 same experiment
 EMAGE:31901 same embryo
 EMAGE:31813 same embryo
 EMAGE:31824 same embryo
 EMAGE:30918 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS