Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31824

Psme3 ( MGI:1096366)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31824 EMAGE:31824 EMAGE:31824 EMAGE:31824 EMAGE:31824
euxassay_006198_01 euxassay_006198_02 euxassay_006198_03 euxassay_006198_04 euxassay_006198_05
EMAGE:31824 EMAGE:31824 EMAGE:31824 EMAGE:31824 EMAGE:31824
euxassay_006198_06 euxassay_006198_07 euxassay_006198_08 euxassay_006198_09 euxassay_006198_10
EMAGE:31824 EMAGE:31824 EMAGE:31824 EMAGE:31824 EMAGE:31824
euxassay_006198_11 euxassay_006198_12 euxassay_006198_13 euxassay_006198_14 euxassay_006198_15
EMAGE:31824 EMAGE:31824 EMAGE:31824 EMAGE:31824 EMAGE:31824
euxassay_006198_16 euxassay_006198_17 euxassay_006198_18 euxassay_006198_19 euxassay_006198_20
EMAGE:31824 EMAGE:31824
euxassay_006198_21 euxassay_006198_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T497
Entity Detected:Psme3, ( MGI:1096366)
Sequence:sense strand is shown

>T497
TCCTCGAGNCTGTTGGCCTACTGGTAAAGCCGGGAGGGCGAGCGAGAGAGCAAGCAGCCAGCAGGCGGGC
GGGCGGGTGGCCGGCCGGCACGGAGGGAGGGGACGAGCAAGCGGTGAGCAAGCCAGCGAGGGTGCCCGGG
TCCCGAGGGCAACGGAGATTCCTCAGGCCCCTCCGGTGCCCTCCCCGGAGCCCAGAGCACCTCCGGCACC
CAGCGGAGCGGACACGGCCCGGCCTGGCCATGGCCTCGTTGCTGAAGGTGGATCAGGAAGTGAAGCTCAA
GGTTGATTCTTTCAGAGAGCGGATCACAAGTGAGGCAGAAGACTTGGTGGCAAATTTTTTCCCAAAGAAG
TTACTAGAACTTGATAGTTTTTTGAAGGAACCAATTCTAAATATCCATGACCTAACTCAGATCCACTCAG
ACATGAACCTCCCAGTCCCTGACCCCATTCTCCTCACCAATAGCCACGATGGACTGGATGGTCCCACTTA
CAAGAAGCGCAGGTTGGATGAATGTGAAGAGGCCTTTCAAGGAACCAAGGTGTTTGTG
Notes:The probe template was PCR amplified from IMAGE:1481423 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1481423 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006198 same experiment
 EMAGE:31901 same embryo
 EMAGE:31813 same embryo
 EMAGE:31781 same embryo
 EMAGE:30918 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS