Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32111

Dcn decorin ( MGI:94872)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32111 EMAGE:32111 EMAGE:32111 EMAGE:32111 EMAGE:32111
euxassay_006312_01 euxassay_006312_02 euxassay_006312_03 euxassay_006312_04 euxassay_006312_05
EMAGE:32111 EMAGE:32111 EMAGE:32111 EMAGE:32111 EMAGE:32111
euxassay_006312_06 euxassay_006312_07 euxassay_006312_08 euxassay_006312_09 euxassay_006312_10
EMAGE:32111 EMAGE:32111 EMAGE:32111 EMAGE:32111 EMAGE:32111
euxassay_006312_11 euxassay_006312_12 euxassay_006312_13 euxassay_006312_14 euxassay_006312_15
EMAGE:32111 EMAGE:32111 EMAGE:32111 EMAGE:32111 EMAGE:32111
euxassay_006312_16 euxassay_006312_17 euxassay_006312_18 euxassay_006312_19 euxassay_006312_20
EMAGE:32111 EMAGE:32111 EMAGE:32111 EMAGE:32111
euxassay_006312_21 euxassay_006312_22 euxassay_006312_23 euxassay_006312_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 09 15 16 17 18 19
trigeminal v nerve maxillary division
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 07 19 20 21
spinal cord meninges
strong strong
regionalstrong expression: see section 09 12 moderate expression: see section 10 11 13 14
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
midbrain meninges
strong strong
regionalstrong expression: see section 09 10 11 14 15 16 17 18 moderate expression: see section 07 08 12 13 19 20
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08
palatal shelf
moderate moderate
regionalmoderate expression: see section 10 11 14 weak expression: see section 13
diencephalon meninges
strong strong
regionalstrong expression: see section 09 10 11 14 15 16 17 18 moderate expression: see section 08 12 13 19
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 09 10 11 14 15 16 17 18 22 23 24 moderate expression: see section 04 05 06 07 08 12 13 19 20 21
tongue muscle
moderate moderate
regionalmoderate expression: see section 10 11 13 14
hindbrain meninges
strong strong
regionalstrong expression: see section 09 10 11 14 15 16 17 18 moderate expression: see section 05 06 07 08 12 13 19 20 21
bladder
strong strong
regionalstrong expression: see section 12 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35006
Entity Detected:Dcn, decorin ( MGI:94872)
Sequence:sense strand is shown

>T35006
CTTCCTTCTGGCACAAGTCTCTTGGGCTGGACCATTTGAACAGAGAGGCTTATTTGACTTCATGCTAGAA
GATGAGGCTTCTGGCATAATCCCTTATGACCCTGACAATCCCCTGATATCTATGTGCCCCTACCGATGCC
AGTGTCATCTTCGAGTGGTGCAGTGTTCTGATCTGGGTTTGGACAAAGTGCCCTGGGATTTTCCACCCGA
CACAACCTTGCTAGACCTGCAAAACAACAAAATTACAGAGATCAAAGAAGGGGCCTTCAAGAACCTGAAG
GACTTGCATACCTTGATCCTTGTCAACAACAAGATCAGCAAAATCAGTCCAGAGGCATTCAAACCTCTCG
TGAAGTTGGAAAGGCTTTACCTGTCTAAGAACCAACTAAAGGAACTGCCTGAAAAAATGCCCAGAACTCT
CCAGGAACTTCGTGTCCATGAGAATGAGATCACCAAGCTGCGGAAATCCGACTTCAATGGACTGAACAAT
GTGCTTGTCATAGAACTGGGCGGCAACCCACTGAAAAACTCTGGGATTGAAAACGGAGCCTTCCAGGGAC
TGAAGAGTCTCTCATACATTCGCATCTCAGACACCAACATAACTGCGATCCCTCAAGGTCTGCCTACTTC
TCTCACTGAAGTGCATCTAGATGGCAACAAGATCACCAAGGTTGATGCACCCAGCCTGAAAGGACTGATT
AATTTGTCTAAACTGGGATTGAGCTTCAACAGCATCACCGTTATGGAGAATGGCAGTCTGGCCAATGTTC
CTCATCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 50055. Forward Primer - name:050055_F_cDNA_Dcn, sequence:CTTCCTTCTGGCACAAGTCTCT; Reverse Primer - name:050055_N_SP6_cDNA_Dcn, sequence:AGATGAGGAACATTGGCCAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006312 same experiment
 EMAGE:31559 same embryo
 EMAGE:31586 same embryo
 EMAGE:30711 same embryo
 EMAGE:31621 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS