Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32235

AI987944 ( MGI:2142079)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32235 EMAGE:32235 EMAGE:32235 EMAGE:32235 EMAGE:32235
euxassay_016525_01 euxassay_016525_02 euxassay_016525_03 euxassay_016525_04 euxassay_016525_05
EMAGE:32235 EMAGE:32235 EMAGE:32235 EMAGE:32235 EMAGE:32235
euxassay_016525_06 euxassay_016525_07 euxassay_016525_08 euxassay_016525_09 euxassay_016525_10
EMAGE:32235 EMAGE:32235 EMAGE:32235 EMAGE:32235 EMAGE:32235
euxassay_016525_11 euxassay_016525_12 euxassay_016525_13 euxassay_016525_14 euxassay_016525_15
EMAGE:32235 EMAGE:32235 EMAGE:32235 EMAGE:32235 EMAGE:32235
euxassay_016525_16 euxassay_016525_17 euxassay_016525_18 euxassay_016525_19 euxassay_016525_20
EMAGE:32235 EMAGE:32235 EMAGE:32235 EMAGE:32235
euxassay_016525_21 euxassay_016525_22 euxassay_016525_23 euxassay_016525_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 15
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 17 19 20 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38948
Entity Detected:AI987944, ( MGI:2142079)
Sequence:sense strand is shown

>T38948
AATGCCTTTACGCATCACTGTAATTTTGAGTGCTGATAAAACTCATACTGAATAGATAAAACTTATACTG
AATGGAATTTTTGACTATAAAAGATTTGATAAGATTTTTAGCCAATACATTTACATTAAGTTATAGAAAA
TTATTTATTCAGAGGAATAAACCTGACAACTTTCAACAAAGTATTCAAGAATTATGTCCCTCTGTTATGC
ACTGATGACCTGGAAGAAATA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 270043. Forward Primer - name:270043_F_cDNA_AI987944, sequence:AATGCCTTTACGCATCACTGT; Reverse Primer - name:270043_N_SP6_cDNA_AI987944, sequence:TATTTCTTCCAGGTCATCAGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016525 same experiment
 EMAGE:31918 same embryo
 EMAGE:32208 same embryo
 EMAGE:31915 same embryo
 EMAGE:32205 same embryo
 EMAGE:32234 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS