Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7769

Apc adenomatosis polyposis coli ( MGI:88039)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7769 EMAGE:7769 EMAGE:7769 EMAGE:7769 EMAGE:7769
"Pseudo-wholemount" of euxassay_007660. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007660_01 euxassay_007660_02 euxassay_007660_03 euxassay_007660_04
EMAGE:7769 EMAGE:7769 EMAGE:7769 EMAGE:7769 EMAGE:7769
euxassay_007660_05 euxassay_007660_06 euxassay_007660_07 euxassay_007660_08 euxassay_007660_09
EMAGE:7769 EMAGE:7769 EMAGE:7769 EMAGE:7769 EMAGE:7769
euxassay_007660_10 euxassay_007660_11 euxassay_007660_12 euxassay_007660_13 euxassay_007660_14
EMAGE:7769 EMAGE:7769 EMAGE:7769 EMAGE:7769 EMAGE:7769
euxassay_007660_15 euxassay_007660_16 euxassay_007660_17 euxassay_007660_18 euxassay_007660_19
EMAGE:7769 EMAGE:7769 EMAGE:7769 EMAGE:7769 EMAGE:7769
euxassay_007660_20 euxassay_007660_21 euxassay_007660_22 euxassay_007660_23 euxassay_007660_24
EMAGE:7769
euxassay_007660_25

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7769Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7769_wholemount_strong.wlz
7769_wholemount_moderate.wlz
7769_wholemount_weak.wlz
7769_wholemount_possible.wlz
7769_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7769_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
hindbrain
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 07 08 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 16
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 09 15 16
cervical ganglion
weak weak
regionalweak expression: see section 08 16 17
thoracic ganglion
weak weak
regionalweak expression: see section 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 16 17 18
neural retina
strong strong
regionalstrong expression: see section 01 02 03 22 23 24 25
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35939
Entity Detected:Apc, adenomatosis polyposis coli ( MGI:88039)
Sequence:sense strand is shown

>T35939
CCTCAAGACTCCAGCCTCTAAAAGCCCCAGTGAAGGGCCGGGAGCTACCACTTCTCCTCGAGGAACTAAG
CCAGCAGGAAAGTCAGAGCTTAGCCCTATCACCAGGCAAACTTCCCAAATCAGTGGGTCAAATAAGGGGT
CTTCTAGATCAGGATCTAGAGACTCCACTCCCTCAAGACCTACACAGCAACCATTAAGTAGGCCAATGCA
GTCTCCAGGGCGAAACTCAATTTCCCCTGGTAGAAATGGAATAAGCCCTCCTAACAAACTGTCTCAGCTG
CCCAGAACATCATCTCCCAGTACTGCTTCAACTAAGTCCTCCGGTTCTGGGAAAATGTCATATACATCCC
CAGGTAGACAGCTGAGCCAACAAAATCTTACCAAACAAGCAAGTTTATCCAAGAATGCCAGCAGTATCCC
CAGAAGTGAGTCGGCATCTAAAGGACTGAATCAGATGAGTAACGGCAATGGGTCAAATAAAAAGGTAGAA
CTTTCTAGAATGTCTTCAACTAAATCAAGTGGAAGTGAATCAGACAGCTCAGAAAGGCCTGCATTAGTAC
GCCAGTCTACTTTCATCAAAGAAGCCCCAAGCCCAACCCTGAGGAGGAAACTGGAGGAATCTGCCTCATT
TGAATCCCTTTCTCCATCTTCTAGACCAGATTCTCCCACCAGGTCGCAGGCACAGACCCCAGTTTTAAGC
CCTTCCCTTCCTGATATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97369. Forward Primer - name:097369_F_cDNA_Apc, sequence:CCTCAAGACTCCAGCCTCTAAA; Reverse Primer - name:097369_N_SP6_cDNA_Apc, sequence:CATATCAGGAAGGGAAGGGCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7770 same embryo
 EMAGE:7773 same embryo
 EMAGE:7774 same embryo
 EMAGE:7772 same embryo
 EMAGE:7771 same embryo
 EurExpress:euxassay_007660 same experiment
 MGI:4823172 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS