Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8311

Nrg1 neuregulin 1 ( MGI:96083)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8311 EMAGE:8311 EMAGE:8311 EMAGE:8311 EMAGE:8311
"Pseudo-wholemount" of euxassay_007625. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007625_01 euxassay_007625_02 euxassay_007625_03 euxassay_007625_04
EMAGE:8311 EMAGE:8311 EMAGE:8311 EMAGE:8311 EMAGE:8311
euxassay_007625_05 euxassay_007625_06 euxassay_007625_07 euxassay_007625_08 euxassay_007625_09
EMAGE:8311 EMAGE:8311 EMAGE:8311 EMAGE:8311 EMAGE:8311
euxassay_007625_10 euxassay_007625_11 euxassay_007625_12 euxassay_007625_13 euxassay_007625_14
EMAGE:8311 EMAGE:8311 EMAGE:8311 EMAGE:8311 EMAGE:8311
euxassay_007625_15 euxassay_007625_16 euxassay_007625_17 euxassay_007625_18 euxassay_007625_19
EMAGE:8311 EMAGE:8311 EMAGE:8311 EMAGE:8311 EMAGE:8311
euxassay_007625_20 euxassay_007625_21 euxassay_007625_22 euxassay_007625_23 euxassay_007625_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8311Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8311_wholemount_strong.wlz
8311_wholemount_moderate.wlz
8311_wholemount_weak.wlz
8311_wholemount_possible.wlz
8311_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8311_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
weak weak
regionalweak expression: see section 10 11 12 15
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16
olfactory cortex ventricular layer
weak weak
regionalweak expression: see section 10 11 12 16 17 18
telencephalon ventricular layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 10 12 16 17
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 04 05 06 07 08 09 12 13 16 17 18 19 20
pons mantle layer
strong strong
regionalstrong expression: see section 08 18 weak expression: see section 19
midbrain mantle layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 21 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 18 19 weak expression: see section 07 08
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 09 18 19 20 21 22 23 weak expression: see section 07 08
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 09 18 19 20 weak expression: see section 07 08
ventral grey horn
strong strong
regionalstrong expression: see section 11 12 13 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 14 15 16 17 18
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 10 11 12 13 15 16 17 18 19
vomeronasal organ
weak weak
regionalweak expression: see section 13 16
testis
weak weak
regionalweak expression: see section 04 05 06 07 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36700
Entity Detected:Nrg1, neuregulin 1 ( MGI:96083)
Sequence:sense strand is shown

>T36700
CTTTCCACATCTACATCCACGACTGGGACCAGCCATCTCATAAAGTGTGCGGAGAAGGAGAAAACTTTCT
GTGTGAATGGAGGCGAGTGCTTCATGGTGAAGGACCTGTCAAACCCCTCAAGATACTTGTGCAAGTGCCC
AAATGAGTTTACTGGTGATCGTTGCCAAAACTACGTAATGGCCAGCTTCTACAAGCATCTTGGGATTGAA
TTTATGGAAGCGGAGGAGCTCTACCAGAAGAGGGTACTGACAATTACTGGCATCTGTATCGCCCTGTTGG
TGGTCGGCATCATGTGTGTGGTGGCCTACTGCAAAACCAAGAAACAGCGGCAGAAGCTTCATGATCGGCT
CCGGCAGAGCCTTCGGTCAGAACGAAACAACATGGTGAACATAGCGAATGGCCCTCACCATCCAAACCCA
CCACCAGAGAATGTGCAACTGGTGAATCAATATGTATCTAAAAACGTCATCTCCAGTGAGCATATTGTGG
AGAGAGAAGTGGAGACCTCCTTTTCCACCAGTCACTACACTTCCACAGCTCATCACTCCACGACTGTCAC
CCAGACTCCTAGTCACAGCTGGAGTAATGGGCACACAGAAAGCATCATTTCAGAAAGCCACTCTGTAATC
ATGATGTCATCGGTAGAGAACAGCAGGCACAGCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 81238. Forward Primer - name:081238_F_cDNA_Nrg1, sequence:CTTTCCACATCTACATCCACGA; Reverse Primer - name:081238_N_SP6_cDNA_Nrg1, sequence:TGCTGTGCCTGCTGTTCTCTA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8309 same embryo
 EMAGE:8308 same embryo
 EMAGE:8307 same embryo
 EMAGE:8312 same embryo
 EMAGE:8310 same embryo
 EurExpress:euxassay_007625 same experiment
 MGI:4826791 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS