Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8569

Rnf38 ring finger protein 38 ( MGI:1920719)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8569 EMAGE:8569 EMAGE:8569 EMAGE:8569 EMAGE:8569
"Pseudo-wholemount" of euxassay_009782. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009782_01 euxassay_009782_02 euxassay_009782_03 euxassay_009782_04
EMAGE:8569 EMAGE:8569 EMAGE:8569 EMAGE:8569 EMAGE:8569
euxassay_009782_05 euxassay_009782_06 euxassay_009782_07 euxassay_009782_08 euxassay_009782_09
EMAGE:8569 EMAGE:8569 EMAGE:8569 EMAGE:8569 EMAGE:8569
euxassay_009782_10 euxassay_009782_11 euxassay_009782_12 euxassay_009782_13 euxassay_009782_14
EMAGE:8569 EMAGE:8569 EMAGE:8569 EMAGE:8569 EMAGE:8569
euxassay_009782_15 euxassay_009782_16 euxassay_009782_17 euxassay_009782_18 euxassay_009782_19
EMAGE:8569 EMAGE:8569 EMAGE:8569 EMAGE:8569
euxassay_009782_20 euxassay_009782_21 euxassay_009782_22 euxassay_009782_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8569Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8569_wholemount_strong.wlz
8569_wholemount_moderate.wlz
8569_wholemount_weak.wlz
8569_wholemount_possible.wlz
8569_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8569_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 06 18 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 16 17 18
spinal cord
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 11 12 13 14 15 16
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 22 23
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15 16 17 18
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 12 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30631
Entity Detected:Rnf38, ring finger protein 38 ( MGI:1920719)
Sequence:sense strand is shown

>T30631
TTTGGGTGTTCCTCATCACATGTATATATGGACTATCCATCGAACTTAACCTGTGTGGCTTCCAGCCCTC
CCTTTACCAAAAGGGTCAATGGACCTTTCTTTGCACTGTGTGACTTAATCAACTATAAAAGCTTACAATT
AGTCTTCACAATTATGGGATTGTTATACTAACTGTGTGATTGGAACTCCAAAGACCTTTTCTTTAGCTTA
ATTTTGTGTGTGCACTAACATTCCCTGGTTTTTGTGTGATCATTCCGAGTGTTGCTGCAAGATTACAGTG
GACGTGATCTTTTAGCATGTGCTTTTATAAAAAGTGGTAGCTCCAGATGATATAGCAATCTACCTTATAT
AGAGCCTTCAGAAACTGTGAGTGGAAGTGAGTGAAGCGTATGACTGCTGGTGATCAGTGAATCTGTGAGA
GAATGTGTGCAACTACATGTGTGGGGGCATGGTAGCTACTGTGTGTGTGAGATCCTATATACCAGCATGT
ACCAAGAATGTGTGTGTAGTTTTAATTATGCTGCAATGTATAATCTGGTGTGTTATTTAAACAGCACTAG
TACTGTACACTGGTTTTCCCTTGTGTTTGCTGTTGCACACTGATTGCTAAGGGTGCATCCATTCTAAGCA
TTGAATACTCCATCCCCTTCCCGCCCAGTGAATGGAATGAGAAAAGCCTTCTTCCTTTGCTTCAGGCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6408623), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59942. Forward Primer - name:059942_F_IRAV115_g04_Rnf38, sequence:TTTGGGTGTTCCTCATCACA; Reverse Primer - name:059942_R_SP6_IRAV115_g04_Rnf38, sequence:GCTGCCTGAAGCAAAGGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8570 same embryo
 EMAGE:8567 same embryo
 EMAGE:8566 same embryo
 EMAGE:8565 same embryo
 EMAGE:8568 same embryo
 EurExpress:euxassay_009782 same experiment
 MGI:4827778 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS