Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8846

Tshz1 teashirt zinc finger family member 1 ( MGI:1346031)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8846 EMAGE:8846 EMAGE:8846 EMAGE:8846 EMAGE:8846
"Pseudo-wholemount" of euxassay_010168. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010168_01 euxassay_010168_02 euxassay_010168_03 euxassay_010168_04
EMAGE:8846 EMAGE:8846 EMAGE:8846 EMAGE:8846 EMAGE:8846
euxassay_010168_05 euxassay_010168_06 euxassay_010168_07 euxassay_010168_08 euxassay_010168_09
EMAGE:8846 EMAGE:8846 EMAGE:8846 EMAGE:8846 EMAGE:8846
euxassay_010168_10 euxassay_010168_11 euxassay_010168_12 euxassay_010168_13 euxassay_010168_14
EMAGE:8846 EMAGE:8846 EMAGE:8846 EMAGE:8846 EMAGE:8846
euxassay_010168_15 euxassay_010168_16 euxassay_010168_17 euxassay_010168_18 euxassay_010168_19
EMAGE:8846 EMAGE:8846 EMAGE:8846
euxassay_010168_20 euxassay_010168_21 euxassay_010168_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8846Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8846_wholemount_strong.wlz
8846_wholemount_moderate.wlz
8846_wholemount_weak.wlz
8846_wholemount_possible.wlz
8846_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8846_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
interdigital region between forelimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 01 02 03 04
interdigital region between forelimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 01 02 03
interdigital region between forelimb digits 3 and 4
moderate moderate
regionalmoderate expression: see section 01 22
interdigital region between hindlimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 05 06 07 17 18 19 20
interdigital region between hindlimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 17 18 19 20
interdigital region between hindlimb digits 3 and 4
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 17 18 19
interdigital region between hindlimb digits 4 and 5
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 18
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 16 17 18 19 20
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 18 19 20 21 22
olfactory cortex mantle layer
strong strong
regionalstrong expression: see section 09 10 11 14 15 16 17 18
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 18 19 20
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 08 13 14 18 19 moderate expression: see section 09 10 12 20 21 weak expression: see section 11 15
midbrain mantle layer
weak weak
regionalweak expression: see section 10 11 12 13 14 18 19 20
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 22
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 09 10 12 13 14 15 16 17 18 moderate expression: see section 08 11
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 05 weak expression: see section 06 07
midgut
weak weak
regionalweak expression: see section 12 13 14 15 16 18
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 09 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31822
Entity Detected:Tshz1, teashirt zinc finger family member 1 ( MGI:1346031)
Sequence:sense strand is shown

>T31822
GCTGGGGATGCAGAGAGAAAAATCAAAGAGGAGACTGAAGATGCCACTGAGAAGTTTGAGCCCACTGCCC
TTTATCAGTACCTGCGTGAGGAAGACCTAGATGACAGCCCCAAGGGAGGAGTAGATATCCTAAAGTCACT
CGAGAACACTGTGTCCACGGCCATCAGTAAAGCCCAGAATGGGGCACCCTCATGGGGTGGGTACCCCAGC
ATCCATGCAGCCTACCAGCTGCCAGGCACAGTGAAGCCACTGCAGTCTGCTGTGCAGAGCGTGCAAATAC
AGCCGTCTTACGCCAGCAGCGTGAAGTCACTGTCCTCCACAGAGCACAATGCCCTCCTACACTCCCCAGG
GAGCCTCACCCCGCCACCCCATAAGAGCAATGTGTCTGCCATGGAGGAGTTAGTAGAGAAGGTCACGGGC
AAGGTCAGCATCAAGAAGGAGGAGAGGCCTACTGAGAAGGAGAAGAGCTCCCCTGTCAAAGCCATCTCTC
CTGTGGCAAAGGAGAATAAAGATCTTCCTAAGACAGAGGAGACCGGGAGCAAGCCACAGAAGAAGGGCTC
GGATTCAGAAACTGGGAAGGCCAAAAAGGAGAGTACATTGGACGCTCACACCCCAAATGGTACAGAACCT
CTTAAAGCCAAGGTCACCAATGGCTGCGGCCATCTGGGTATCATCACGGACCACTCGCCGGAGCCTTCTT
TCATCAACCCTCTAAGCGCTCTGCAGTCCATCATGAACACCCACCTAGGAAAGGTGTCCAAGCCCGTGAG
CCCCTCTCTGGATCCACTGGCGATGCTCTACAAGATCAGCAACAGCATGCTGGACAAGCCCGTCTACCCC
ACGACCCCTGCCAAGCAGGCTGATGCAATCGACCGCTACTACTATGAGAACAGCGACCAGCCCATTGATC
TGACCAAGTCTAAGAACAAGCCACTGGTCTCGGGTGTGGCAGATGCTGTGTCCTCGCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6488400), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59418. Forward Primer - name:059418_F_IRAV99_f12_Sdccag33, sequence:GCTGGGGATGCAGAGAGA; Reverse Primer - name:059418_R_SP6_IRAV99_f12_Sdccag33, sequence:GAGGCGAGGACACAGCAT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8845 same embryo
 EMAGE:8844 same embryo
 EMAGE:8843 same embryo
 EMAGE:8847 same embryo
 EMAGE:8848 same embryo
 EurExpress:euxassay_010168 same experiment
 MGI:4828952 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS