Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8931

Hs3st2 heparan sulfate (glucosamine) 3-O-sulfotransferase 2 ( MGI:1333802)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8931 EMAGE:8931 EMAGE:8931 EMAGE:8931 EMAGE:8931
"Pseudo-wholemount" of euxassay_012864. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012864_01 euxassay_012864_02 euxassay_012864_03 euxassay_012864_04
EMAGE:8931 EMAGE:8931 EMAGE:8931 EMAGE:8931 EMAGE:8931
euxassay_012864_05 euxassay_012864_06 euxassay_012864_07 euxassay_012864_08 euxassay_012864_09
EMAGE:8931 EMAGE:8931 EMAGE:8931 EMAGE:8931 EMAGE:8931
euxassay_012864_10 euxassay_012864_11 euxassay_012864_12 euxassay_012864_13 euxassay_012864_14
EMAGE:8931 EMAGE:8931 EMAGE:8931 EMAGE:8931 EMAGE:8931
euxassay_012864_15 euxassay_012864_16 euxassay_012864_17 euxassay_012864_18 euxassay_012864_19
EMAGE:8931 EMAGE:8931
euxassay_012864_20 euxassay_012864_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8931Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8931_wholemount_strong.wlz
8931_wholemount_moderate.wlz
8931_wholemount_weak.wlz
8931_wholemount_possible.wlz
8931_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8931_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 04 05 15 16 17 18 19 20
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 14 15
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 13 weak expression: see section 06 07 14
pons mantle layer
weak weak
regionalweak expression: see section 07 15
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 weak expression: see section 06 07
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 05 17 18 19 weak expression: see section 04
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 15 16 weak expression: see section 04
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 05 06 07 08 15 16 17 18 19 20 weak expression: see section 04
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 14
ventral grey horn
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 12 13 14
neural retina
weak weak
regionalweak expression: see section 02 03 21
mandible
moderate moderate
regionalmoderate expression: see section 04 05 06 07 14 15 16 17 18 weak expression: see section 08 13
lower jaw incisor
weak weak
regionalweak expression: see section 09 10 12 13
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 10 12 13
clavicle
weak weak
regionalweak expression: see section 05 06 07 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38515
Entity Detected:Hs3st2, heparan sulfate (glucosamine) 3-O-sulfotransferase 2 ( MGI:1333802)
Sequence:sense strand is shown

>T38515
TAAGGGAGGAAGCTAACAGCAGCACCCCTAAAACAGCCACACTCTCTGATGATGTGTTGCTTCTGCACCC
CCCCCCCCAGGAGCCTGATGCCGAGGACCTTGGAGACCCAGATCACACTGGAGAAGACGCCCAGCTATTT
CGTCACTCAAGAAGCCCCTCGACGGATCTTCAACATGTCACGAGACACCAAGCTGATAGTGGTGGTGCGG
AACCCAGTGACCCGAGCCATCTCTGACTACACGCAGACTCTTTCCAAGAAGCCGGACATCCCCACCTTCG
AGGGCCTGTCCTTCCGCAACCGCAGTCTAGGCCTGGTGGACGTGTCTTGGAACGCTATCCGCATTGGCAT
GTATGCACTGCACCTGGAAAGCTGGCTGCGGTACTTCCCACTGGCCCAGATCCACTTCGTCAGTGGAGAG
CGGCTCATCACCGACCCTGCTGGTGAGATGGGTCGTATTCAGGACTTCCTGGGCATCAAGAGATTCATCA
CAGACAAGCACTTCTACTTCAACAAGACCAAAGGATTCCCTTGCTTGAAAAAACCAGAGTCAACCCTCCT
GCCTCGATGCCTGGGCAAATCAAAAGGGAGAACTCATGTACAGATCGACCCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 149446. Forward Primer - name:149446_F_cDNA_Hs3st2, sequence:TAAGGGAGGAAGCTAACAGCAG; Reverse Primer - name:149446_N_SP6_cDNA_Hs3st2, sequence:CAGGGTCGATCTGTACATGAGTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8928 same embryo
 EMAGE:8933 same embryo
 EMAGE:8929 same embryo
 EMAGE:8930 same embryo
 EMAGE:8932 same embryo
 EurExpress:euxassay_012864 same experiment
 MGI:4825453 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS