Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10117

Trip10 thyroid hormone receptor interactor 10 ( MGI:2146901)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10117 EMAGE:10117 EMAGE:10117 EMAGE:10117 EMAGE:10117
"Pseudo-wholemount" of euxassay_000162. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000162_01 euxassay_000162_02 euxassay_000162_03 euxassay_000162_04
EMAGE:10117 EMAGE:10117 EMAGE:10117 EMAGE:10117 EMAGE:10117
euxassay_000162_05 euxassay_000162_06 euxassay_000162_07 euxassay_000162_08 euxassay_000162_09
EMAGE:10117 EMAGE:10117 EMAGE:10117 EMAGE:10117 EMAGE:10117
euxassay_000162_10 euxassay_000162_11 euxassay_000162_12 euxassay_000162_13 euxassay_000162_14
EMAGE:10117 EMAGE:10117 EMAGE:10117 EMAGE:10117 EMAGE:10117
euxassay_000162_15 euxassay_000162_16 euxassay_000162_17 euxassay_000162_18 euxassay_000162_19
EMAGE:10117 EMAGE:10117 EMAGE:10117 EMAGE:10117 EMAGE:10117
euxassay_000162_20 euxassay_000162_21 euxassay_000162_22 euxassay_000162_23 euxassay_000162_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10117Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10117_wholemount_strong.wlz
10117_wholemount_moderate.wlz
10117_wholemount_weak.wlz
10117_wholemount_possible.wlz
10117_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10117_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 08
otic capsule
moderate moderate
homogeneousmoderate expression: see section 02 03 04 08
inner ear vestibular component
moderate moderate
regionalmoderate expression: see section 08
axial skeleton
moderate moderate
homogeneousmoderate expression: see section 10
cranium
strong strong
homogeneousstrong expression: see section 02 moderate expression: see section 01
basioccipital bone
strong strong
regionalstrong expression: see section 02 moderate expression: see section 06 08 17 18 19 20 23 24
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 03 04 05 08 12 13 14 15 16 17 22 23 24 not examined expression: see section 02
exoccipital bone
moderate moderate
homogeneousmoderate expression: see section 04
foramen ovale of chondrocranium
moderate moderate
homogeneousmoderate expression: see section 04 05 06 20
foramen rotundum
moderate moderate
homogeneousmoderate expression: see section 05 18
sphenoid bone
moderate moderate
homogeneousmoderate expression: see section 05 06 07 09 12
vault of skull
moderate moderate
homogeneousmoderate expression: see section 01 not examined expression: see section 02
frontal bone primordium
strong strong
homogeneousstrong expression: see section 02 moderate expression: see section 03 06 09 17 22 24
inter-parietal bone primordium
moderate moderate
regionalmoderate expression: see section 21 22
temporal bone
moderate moderate
regionalmoderate expression: see section 24
orbito-sphenoid
moderate moderate
homogeneousmoderate expression: see section 09 10 20 21
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
moderate moderate
spottedmoderate expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1561
Entity Detected:Trip10, thyroid hormone receptor interactor 10 ( MGI:2146901)
Sequence:sense strand is shown

>T1561
GCCCCGCATTGCAGAGACCCTGGGCAACATTGAGAGGCTGAAGTTGGAAGTGCAGAAGTATGAGGCTTGG
TTGGCAGAAGCTGAAAGCCGGGTCCTCAGTAACCGAGGGGACAGCCTAAGCCGTCACGCTAGGCCCCCTG
ATCCCCCAACTACTGCCCCACCTGATAGCAGCAGTAGCAGCACCAACAGTGGATCCCAGGACAATAAGGA
GAGCTCAGAAGAGCCCCCTTCAGAAGGCCAGGACACCCCCATCTATACTGAGTTCGATGAGGACTTTGAG
GAGCCTGCATCCCCTATCGGCCAGTGTGTGGCTATCTACCATTTTGAAGGATCCAGCGAGGGAACCGTCT
CCATGTCCGAGGGGGAAGACCTCAGCCTGATGGAGGAAGACAAGGGTGATGGATGGACGCGGGTCAGGAG
GAAACAGGGAGCTGAGGGCTACGTGCCCACCTCTTACCTCCGAGTCACACTCAACTGAACCCCACCAGAG
GGGGACGAGGGGCAGGGCTGTCAGCTGCTGCTT
Notes:The probe template was PCR amplified from IMAGE:907193 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:907193 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10120 same embryo
 EMAGE:10122 same embryo
 EMAGE:10119 same embryo
 EMAGE:10121 same embryo
 EMAGE:10118 same embryo
 EurExpress:euxassay_000162 same experiment
 MGI:4828923 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS