Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10276

Rheb Ras homolog enriched in brain ( MGI:97912)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10276 EMAGE:10276 EMAGE:10276 EMAGE:10276 EMAGE:10276
"Pseudo-wholemount" of euxassay_000326. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000326_01 euxassay_000326_02 euxassay_000326_03 euxassay_000326_04
EMAGE:10276 EMAGE:10276 EMAGE:10276 EMAGE:10276 EMAGE:10276
euxassay_000326_05 euxassay_000326_06 euxassay_000326_07 euxassay_000326_08 euxassay_000326_09
EMAGE:10276 EMAGE:10276 EMAGE:10276 EMAGE:10276 EMAGE:10276
euxassay_000326_10 euxassay_000326_11 euxassay_000326_12 euxassay_000326_13 euxassay_000326_14
EMAGE:10276 EMAGE:10276 EMAGE:10276 EMAGE:10276 EMAGE:10276
euxassay_000326_15 euxassay_000326_16 euxassay_000326_17 euxassay_000326_18 euxassay_000326_19
EMAGE:10276 EMAGE:10276 EMAGE:10276 EMAGE:10276 EMAGE:10276
euxassay_000326_20 euxassay_000326_21 euxassay_000326_22 euxassay_000326_23 euxassay_000326_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10276Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10276_wholemount_strong.wlz
10276_wholemount_moderate.wlz
10276_wholemount_weak.wlz
10276_wholemount_possible.wlz
10276_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10276_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
olfactory lobe
strong strong
homogeneousstrong expression: see section 06
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 04 05 07 08 09 10 16 17 18 19 20 21 moderate expression: see section 02 03 14 22
midbrain
strong strong
homogeneousstrong expression: see section 16 not examined expression: see section 14
otic capsule
strong strong
regionalstrong expression: see section 05 moderate expression: see section 03 04
nucleus pulposus
strong strong
spottedstrong expression: see section 15
basioccipital bone
moderate moderate
regionalmoderate expression: see section 02
basisphenoid bone
strong strong
regionalstrong expression: see section 04 21 22 23 moderate expression: see section 02 03 05
tail dorsal root ganglion
strong strong
homogeneousstrong expression: see section 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3624
Entity Detected:Rheb, Ras homolog enriched in brain ( MGI:97912)
Sequence:sense strand is shown

>T3624
GCGCCATCCTGGGCTACCGGTCTGTGGGAAAGTCCTCATTGACAATTCAGTTTGTTGAAGGCCAATTTGT
TGATTCCTACGATCCAACCATAGAGAACACGTTCACCAAGTTGATCACGGTAAATGGTCAAGAGTATCAT
CTTCAGCTTGTAGACACAGCGGGGCAGGATGAATATTCCATTTTTCCTCAGACATACTCCATAGATATTA
ATGGTTATATTCTTGTGTATTCTGTTACATCAATCAAAAGTTTTGAAGTAATTAAAGTTATCCATGGCAA
GTTGTTGGATATGGTGGGGAAAGTGCAGATACCTATTATGTTGGTTGGAAATAAGAAGGACCTGCATATG
GAAAGGGTGATCAGCTATGAAGAAGGAAAGGCTTTGGCAGAATCTTGGAATGCAGCTTTTTTGGAATCTT
CTGCTAAAGAAAATCAAACTGCTGTTGATGTTTTTAAAAGGATAATTTTGGAAGCAGAAAAGATTGATGG
AGCAGCTTCACAAGGAAAGTCTTCGTGCTCGGTGATGTGACAATTCTGCTGCAGAGCCTG
Notes:The probe template was PCR amplified from IMAGE:3167986 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3167986 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10280 same embryo
 EMAGE:10279 same embryo
 EMAGE:10278 same embryo
 EMAGE:10281 same embryo
 EMAGE:10277 same embryo
 EurExpress:euxassay_000326 same experiment
 MGI:4827730 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS