Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10279

Snx3 sorting nexin 3 ( MGI:1860188)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10279 EMAGE:10279 EMAGE:10279 EMAGE:10279 EMAGE:10279
"Pseudo-wholemount" of euxassay_000302. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000302_17 euxassay_000302_18 euxassay_000302_19 euxassay_000302_20
EMAGE:10279 EMAGE:10279 EMAGE:10279 EMAGE:10279 EMAGE:10279
euxassay_000302_21 euxassay_000302_22 euxassay_000302_23 euxassay_000302_24 euxassay_000302_25
EMAGE:10279 EMAGE:10279 EMAGE:10279 EMAGE:10279 EMAGE:10279
euxassay_000302_26 euxassay_000302_27 euxassay_000302_28 euxassay_000302_29 euxassay_000302_30
EMAGE:10279 EMAGE:10279 EMAGE:10279 EMAGE:10279 EMAGE:10279
euxassay_000302_31 euxassay_000302_32 euxassay_000302_33 euxassay_000302_34 euxassay_000302_35
EMAGE:10279 EMAGE:10279 EMAGE:10279 EMAGE:10279
euxassay_000302_36 euxassay_000302_37 euxassay_000302_38 euxassay_000302_39

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10279Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10279_wholemount_strong.wlz
10279_wholemount_moderate.wlz
10279_wholemount_weak.wlz
10279_wholemount_possible.wlz
10279_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10279_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
spottedmoderate expression: see section 29 30 31 32 weak expression: see section 33
cerebral cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 19 20 21 22 23 24 25 26 31 32 33 34 35 36 37 38
nucleus pulposus
moderate moderate
spottedmoderate expression: see section 31
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3622
Entity Detected:Snx3, sorting nexin 3 ( MGI:1860188)
Sequence:sense strand is shown

>T3622
GAGCGGACACCCGGCGGCTCATCACCAAGCCGCAGAATCTGAATGACGCCTACGGGCCGCCCAGCAACTT
CCTCGAGATCGACGTGAGCAACCCGCAGACCGTGGGGGTCGGCCGGGGCCGCTTCACCACCTACGAGATC
AGGGTCAAGACAAATCTTCCTATCTTCAAGCTGAAGGAATCTACTGTTAGAAGAAGATACAGTGACTTTG
AGTGGCTTCGAAGTGAACTAGAAAGAGAGAGCAAGGTTGTAGTTCCCCCACTCCCTGGGAAAGCATTTTT
GCGGCAGCTTCCTTTTAGAGGAGACGATGGAATATTTGATGACAATTTCATCGAGGAAAGGAAGCAAGGG
CTGGAACAGTTCATAAACAAGGTCGCTGGTCATCCTCTGGCCCAGAATGAACGTTGTCTTCACATGTTTT
TACAGGATGAAATTATAGATAAAAGCTATACTCCATCTAAAATAAGACATGCCTGAGTTTGGTGAGAAGC
AGCAAAACCCGAGACCATTAATGATTCATCCGCACCAATGAAGAAGTTGTAACTAACT
Notes:The probe template was PCR amplified from IMAGE:3167981 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3167981 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10280 same embryo
 EMAGE:10278 same embryo
 EMAGE:10281 same embryo
 EMAGE:10277 same embryo
 EMAGE:10276 same embryo
 EurExpress:euxassay_000302 same experiment
 MGI:4828366 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS