Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10299

Pex5 peroxisomal biogenesis factor 5 ( MGI:1098808)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10299 EMAGE:10299 EMAGE:10299 EMAGE:10299 EMAGE:10299
"Pseudo-wholemount" of euxassay_000323. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000323_01 euxassay_000323_02 euxassay_000323_03 euxassay_000323_04
EMAGE:10299 EMAGE:10299 EMAGE:10299 EMAGE:10299 EMAGE:10299
euxassay_000323_05 euxassay_000323_06 euxassay_000323_07 euxassay_000323_08 euxassay_000323_09
EMAGE:10299 EMAGE:10299 EMAGE:10299 EMAGE:10299 EMAGE:10299
euxassay_000323_10 euxassay_000323_11 euxassay_000323_12 euxassay_000323_13 euxassay_000323_14
EMAGE:10299 EMAGE:10299 EMAGE:10299 EMAGE:10299 EMAGE:10299
euxassay_000323_15 euxassay_000323_16 euxassay_000323_17 euxassay_000323_18 euxassay_000323_19
EMAGE:10299 EMAGE:10299 EMAGE:10299 EMAGE:10299 EMAGE:10299
euxassay_000323_20 euxassay_000323_21 euxassay_000323_22 euxassay_000323_23 euxassay_000323_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10299Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10299_wholemount_strong.wlz
10299_wholemount_moderate.wlz
10299_wholemount_weak.wlz
10299_wholemount_possible.wlz
10299_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10299_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 09 10 11
cerebral cortex
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 09
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09
cerebellum
moderate moderate
regionalmoderate expression: see section 03 04 05
midbrain marginal layer
moderate moderate
regionalmoderate expression: see section 08 09
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08
spinal cord
moderate moderate
homogeneousmoderate expression: see section 11
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 09 10
inner ear
moderate moderate
regionalmoderate expression: see section 02
tail dorsal root ganglion
moderate moderate
homogeneousmoderate expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3544
Entity Detected:Pex5, peroxisomal biogenesis factor 5 ( MGI:1098808)
Sequence:sense strand is shown

>T3544
GGTAAGTCTCTCCTTGCCCCATCTTCCTGGGAATTGGTAACAGTCCAGCTTCCTTGGGCAGTTGTGTGTA
AGAGGCTCCCCTGAGCATCTGTGCGACGCCAGCTGGGATGGATGTTAGGAGCTGCCCTGCTCGCTGAAAT
GGTGATGCGGCTCCCTAGAGCCGAACTTGGAACAAGTGCTCGCAGCTCGGTCACTCCGGGAGCGAGCATG
GATCTTCTGTGGGTGGACACTGAAGCAGCAGATGCTCATGTGGTTACTGTACTGTCCTCAGGGCCAGGGC
TTGTCACTGCAGGTGGCCTGGCCTATGGGGGAGGGAGGTTCATTTGTGGAATGAGCCCAGAGATGCGACA
GTAGTGATACGGTCAGCACTGCAGTCCTCTCTTCTTGGGAGACTTGGAAGTAGGAACTAAACAAACTCTT
GTAGCAACCTGGTTCAGAAGTTGCATTCTTGCCAAATTCCCAACCAAGGGAGGGTTCAGTGTTACCATAA
GCCTTCTTGAAACCTTTATAGGGGATATCATT
Notes:The probe template was PCR amplified from IMAGE:3166734 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3166734 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10302 same embryo
 EMAGE:10298 same embryo
 EMAGE:10301 same embryo
 EMAGE:10303 same embryo
 EMAGE:10300 same embryo
 EurExpress:euxassay_000323 same experiment
 MGI:4827160 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS