Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11062

Dtymk deoxythymidylate kinase ( MGI:108396)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11062 EMAGE:11062 EMAGE:11062 EMAGE:11062 EMAGE:11062
"Pseudo-wholemount" of euxassay_001243. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001243_01 euxassay_001243_02 euxassay_001243_03 euxassay_001243_04
EMAGE:11062 EMAGE:11062 EMAGE:11062 EMAGE:11062 EMAGE:11062
euxassay_001243_05 euxassay_001243_06 euxassay_001243_07 euxassay_001243_08 euxassay_001243_09
EMAGE:11062 EMAGE:11062 EMAGE:11062 EMAGE:11062 EMAGE:11062
euxassay_001243_10 euxassay_001243_11 euxassay_001243_12 euxassay_001243_13 euxassay_001243_14
EMAGE:11062 EMAGE:11062 EMAGE:11062 EMAGE:11062 EMAGE:11062
euxassay_001243_15 euxassay_001243_16 euxassay_001243_17 euxassay_001243_18 euxassay_001243_19
EMAGE:11062 EMAGE:11062 EMAGE:11062 EMAGE:11062 EMAGE:11062
euxassay_001243_20 euxassay_001243_21 euxassay_001243_22 euxassay_001243_23 euxassay_001243_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11062Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11062_wholemount_strong.wlz
11062_wholemount_moderate.wlz
11062_wholemount_weak.wlz
11062_wholemount_possible.wlz
11062_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11062_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
homogeneousweak expression: see section 12 13 14 15 16 17
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 18 19 20 21 22
pancreas
weak weak
regionalweak expression: see section 10 11 12 13 14 17 18 19
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
lower jaw incisor
weak weak
regionalweak expression: see section 13 14 15 16 18 19
lower jaw molar
weak weak
regionalweak expression: see section 08 10 11 20 22
upper jaw incisor
weak weak
regionalweak expression: see section 14 15 16 18 19 20
upper jaw molar
weak weak
regionalweak expression: see section 08 10 11 20 22
chondrocranium
moderate moderate
regionalmoderate expression: see section 04 05 06 07 24 weak expression: see section 02 03 08 09 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4675
Entity Detected:Dtymk, deoxythymidylate kinase ( MGI:108396)
Sequence:sense strand is shown

>T4675
GGGCTTCCGTGCACGCCGGGCTTCTGCTGCATCTAACATTGGCGGGAACCTGGCAAGTTGACCGGTGCTG
TGCGGGCGATGGCGTCGCGTCGGGGAGCGCTCATCGTGCTGGAGGGTGTGGACCGTGCTGGCAAGACCAC
GCAGGGCCTCAAGCTGGTGACCGCGCTGTGCGCCTCGGGCCACAGAGCGGAGCTGCTGCGTTTCCCCGAA
AGATCAACGGAAATCGGCAAGCTTCTGAATTCCTACTTGGAAAAGAAAACGGAACTAGAGGATCACTCCG
TGCACCTGCTCTTCTCTGCAAACCGCTGGGAACAAGTGTAAAGACCTGCGTCGTTGCTCCCCGGTTGTAA
CATGCACACTTTTGTGTGTGGCAAGGGTGCGAGCACCTGTGTGTGGCATGTGTGCAAACACCCGCACGTC
GAGACCAGAGGCCAGCTTGGGAGGTTTCCTCTACCCTACCATTCGACGCCGTATTTGAGATAAAAAAATC
GACGTATTTGAGATAAAAAATCGTCGTATTTGAGATAAAAAATCGCCGTATTTGAGATAAAACATCGTCG
TATTTGACCATCGTATTTAACCACATCCGGCTTGTTTTGTTTTATTAAAAGGTTTTTTTTTTGAAAAAAA
AAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:5026527 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:5026527 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11063 same embryo
 EMAGE:11067 same embryo
 EMAGE:11066 same embryo
 EMAGE:11061 same embryo
 EMAGE:11064 same embryo
 EMAGE:11065 same embryo
 EurExpress:euxassay_001243 same experiment
 MGI:4824411 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS