Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11775

Spa17 sperm autoantigenic protein 17 ( MGI:1333778)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11775 EMAGE:11775 EMAGE:11775 EMAGE:11775 EMAGE:11775
"Pseudo-wholemount" of euxassay_006951. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006951_01 euxassay_006951_02 euxassay_006951_03 euxassay_006951_04
EMAGE:11775 EMAGE:11775 EMAGE:11775 EMAGE:11775 EMAGE:11775
euxassay_006951_05 euxassay_006951_06 euxassay_006951_07 euxassay_006951_08 euxassay_006951_09
EMAGE:11775 EMAGE:11775 EMAGE:11775 EMAGE:11775 EMAGE:11775
euxassay_006951_10 euxassay_006951_11 euxassay_006951_12 euxassay_006951_13 euxassay_006951_14
EMAGE:11775 EMAGE:11775 EMAGE:11775 EMAGE:11775 EMAGE:11775
euxassay_006951_15 euxassay_006951_16 euxassay_006951_17 euxassay_006951_18 euxassay_006951_19
EMAGE:11775 EMAGE:11775 EMAGE:11775 EMAGE:11775
euxassay_006951_20 euxassay_006951_21 euxassay_006951_22 euxassay_006951_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11775Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11775_wholemount_strong.wlz
11775_wholemount_moderate.wlz
11775_wholemount_weak.wlz
11775_wholemount_possible.wlz
11775_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11775_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
diencephalon roof plate
strong strong
regionalstrong expression: see section 13 14
choroid invagination
strong strong
regionalstrong expression: see section 06 08 09 10 11 15 16 17 18
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 02 03 04 05 06 08 09 10 11 13 14 15 16 17 18 19 20 moderate expression: see section 12
heart ventricle
weak weak
spottedweak expression: see section 07 08 09 10 11 12 13 14 15 16
lung
moderate moderate
regionalmoderate expression: see section 04
left lung
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13
right lung
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T9915
Entity Detected:Spa17, sperm autoantigenic protein 17 ( MGI:1333778)
Sequence:sense strand is shown

>T9915
GGAACCATCCGCACCAGCTTGAAGAGAAAGAAGAGGTACCATATAGGCAATTCTTTCCGAGGAGATGTCG
ATTCCTTTCTCCAACACCCACTACCGAATTCCACAAGGATTTGGAAATCTTCTTGAAGGGCTGACACGGG
AGATTCTGAGGGAGCAACCGGACAATATACCAGCTTTTGCCGCAGCGTATTTTGAGAACCTTCTAGAGAA
AAGAGAGAAAACCAGCTTTGATCCAGCAGAATGGGGGGCTAAGGTAGAGGACCGCTTCTATAACAACCAC
GCATTCAAGGAACAAGAACAAGTTGAGAAATGTGAACAAGAATTAGCTAAGTCATCTGGAAGAGAAGAAA
CACCAGTCACTCCCTTCGAGGAGTCTACTGAGGAAGAAAGAGAACAGGAGGAGGCGGCTGCTCTCAAAAT
CCAGTCCCTCTTCCGGGGACACGTGGCTAGAGAAGAGGTAAAGAAGATGAAGTCAGATAAGAATGAGAAT
CTGAAAGAAGAGGCAGACAATTGAGACCACAGGTTTTACCCCCCGAAACATGAAAAGTAATCCAAATCCA
TCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:6775177 using vector (pDNR-LIB) specific primers. Forward Primer - name:M13 forward (-21), sequence:TGTAAAACGACGGCCAGT; Reverse Primer - name:T3-pDNR-LIB rv, sequence:CAAATTAACCCTCACTAAAGGGTGTTCACTTACCTACTGGGC. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:6775177 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11779 same embryo
 EMAGE:11777 same embryo
 EMAGE:11780 same embryo
 EMAGE:11778 same embryo
 EMAGE:11776 same embryo
 EurExpress:euxassay_006951 same experiment
 MGI:4828398 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS