Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12665

Itfg1 integrin alpha FG-GAP repeat containing 1 ( MGI:106419)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12665 EMAGE:12665 EMAGE:12665 EMAGE:12665 EMAGE:12665
"Pseudo-wholemount" of euxassay_011448. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011448_01 euxassay_011448_02 euxassay_011448_03 euxassay_011448_04
EMAGE:12665 EMAGE:12665 EMAGE:12665 EMAGE:12665 EMAGE:12665
euxassay_011448_05 euxassay_011448_06 euxassay_011448_07 euxassay_011448_08 euxassay_011448_09
EMAGE:12665 EMAGE:12665 EMAGE:12665 EMAGE:12665 EMAGE:12665
euxassay_011448_10 euxassay_011448_11 euxassay_011448_12 euxassay_011448_13 euxassay_011448_14
EMAGE:12665 EMAGE:12665 EMAGE:12665 EMAGE:12665 EMAGE:12665
euxassay_011448_15 euxassay_011448_16 euxassay_011448_17 euxassay_011448_18 euxassay_011448_19
EMAGE:12665 EMAGE:12665 EMAGE:12665 EMAGE:12665
euxassay_011448_20 euxassay_011448_21 euxassay_011448_22 euxassay_011448_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12665Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12665_wholemount_strong.wlz
12665_wholemount_moderate.wlz
12665_wholemount_weak.wlz
12665_wholemount_possible.wlz
12665_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12665_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 19 20 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
strong strong
regionalstrong expression: see section 08 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 18 19 weak expression: see section 06 07 08 17
trigeminal v nerve
weak weak
regionalweak expression: see section 10 17
spinal cord
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16 17
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 16 17 18
neural retina
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 01 02 04 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30184
Entity Detected:Itfg1, integrin alpha FG-GAP repeat containing 1 ( MGI:106419)
Sequence:sense strand is shown

>T30184
ACGGACCTCTTCGTGCTGCGGGAAAGAAATGACTTAATTGTCTTCTTGGCAGATCAGAGTGCACCCTATT
TTAAACCCAAGGTAAAGGTATCCCTGAAGACTTTGAGTGCGTTGGTAACAAGTGTGGTCCCTGGTGATTA
TGATGGGGATTCACAAATGGATGTCCTGCTCACATACTTTCCCCAAAATCATACCAACAGTGAACTAGGA
GCTGTTATCTTTTGGGGACAAAATCAAACATTAGATCCTAAAAACATGACCATACTCAATAGGACTTTTC
ATGACCAACCACTGATTATGGACTTCAATGGTGATCTAATTCCTGATGTGTTTGGTATCACAAATGAATC
CAGCCAACCGCAGATACTGCTAGGAGGAGATTTATCATGGCATCCTGCCTTGACCACTAAGAGTAAAATG
CGAGATCCACATTCCCATGCATTTATTGATCTGACTGAAGATTTTACAGCAGATTTATTCCTCACGACAT
TGACTGCCTCTAATGCCTTCCAGTTTGAGATATGGGAAAATTTGGGTGGAAACTTCTCTATCCATAGTGT
CTTTGAAAAACCTAAAAATCTGGTGGTGGTTGGACAGTCAGCATTTGCAGACTTTGATGGAGATGGACAC
ATGGATCACTTGCTGCCAGGCTGCGAAGATAAGGACTGTCAGAAAAGTGCCATATATTTAATGAGATCTG
GAACAGGACAGTGGGTTCCTGTGCTTCAGGATTTTAGCAATAAGGGTACACTCTGGGGCTTTGTGCCATT
TGTGCATGAAGAACAACCAACCACAATACCAATCCCACTCACACTTCACATTGGAGACTACAACATGGAC
GGCTACCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3489518), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 8924. Forward Primer - name:ABA_MGC_019_02_G10_F_AGGAACAGGCTCTGGGCT_ABA_FR_019, sequence:ACGGACCTCTTCGTGCTG; Reverse Primer - name:_R_SP6_ABA_MGC_008_02_E03_ACGGACCTCTTCGTGCTGCGGGAA, sequence:TGGGTAGCCGTCCATGTT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12663 same embryo
 EMAGE:12668 same embryo
 EMAGE:12666 same embryo
 EMAGE:12667 same embryo
 EMAGE:12664 same embryo
 EurExpress:euxassay_011448 same experiment
 MGI:4825635 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS