Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13018

Syna syncytin a ( MGI:2684898)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13018 EMAGE:13018 EMAGE:13018 EMAGE:13018 EMAGE:13018
"Pseudo-wholemount" of euxassay_013694. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013694_01 euxassay_013694_02 euxassay_013694_03 euxassay_013694_04
EMAGE:13018 EMAGE:13018 EMAGE:13018 EMAGE:13018 EMAGE:13018
euxassay_013694_05 euxassay_013694_06 euxassay_013694_07 euxassay_013694_08 euxassay_013694_09
EMAGE:13018 EMAGE:13018 EMAGE:13018 EMAGE:13018 EMAGE:13018
euxassay_013694_10 euxassay_013694_11 euxassay_013694_12 euxassay_013694_13 euxassay_013694_14
EMAGE:13018 EMAGE:13018 EMAGE:13018 EMAGE:13018 EMAGE:13018
euxassay_013694_15 euxassay_013694_16 euxassay_013694_17 euxassay_013694_18 euxassay_013694_19
EMAGE:13018 EMAGE:13018 EMAGE:13018 EMAGE:13018 EMAGE:13018
euxassay_013694_20 euxassay_013694_21 euxassay_013694_22 euxassay_013694_23 euxassay_013694_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13018Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13018_wholemount_strong.wlz
13018_wholemount_moderate.wlz
13018_wholemount_weak.wlz
13018_wholemount_possible.wlz
13018_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13018_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 05 06 07 08 21 22 23 24
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 20 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 19
trigeminal v ganglion
weak weak
regionalweak expression: see section 05 06 07 08 09 10 18 19 20 21 22 23
dorsal root ganglion
weak weak
regionalweak expression: see section 10 11 18 19
heart ventricle
moderate moderate
spottedmoderate expression: see section 11 14 15 16 17 18
mandible
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 20 21 22 23 24
orbito-sphenoid
weak weak
regionalweak expression: see section 02 03 04 05 06 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37800
Entity Detected:Syna, syncytin a ( MGI:2684898)
Sequence:sense strand is shown

>T37800
CCCACTAAGGACTTGGACAGAGACACCCATGAAACTTCGAATCATGTACTCAGCCCGGACCCTCTCCGGC
CCATACCCTATCACCGACCTTGAGAGGCGCCTCCAGAATTTCCAACCATTGACTCCCCACTCCTCTTTTG
TCAACCCTGACCAGCGGGCCATTGCTTTCCTTCAGATCACCAGCGTGACAGGCATACTTCCCATACTTTC
TCGGATCACCTCGGTGAGATACCCCGATGACCACGTCTATGAATCTGCCCAGCGCCCCATATGGGGCTCA
CTCTCCACCCAGACGATCCTCACCTCCCAGGCCCCTCTCTGCATATCCCGCTTCTTCAAGAATTCAAACC
ATGCCACCTTCGTGGGCAAACTCCCTGCCTCTCTTTGCAATCACACCTTTCAGCTCTCCCCCTCTGCCAA
CCACCAATCCATAGATCTGTCCTCCAGCTATGCATTCGCCCCATTAATGGCCATGCCAGGGTCTAAATGG
AGAAACCCCTTACGCTTTTCAGGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 79208. Forward Primer - name:079208_F_cDNA_LOC214292, sequence:CCCACTAAGGACTTGGACAGAG; Reverse Primer - name:079208_N_SP6_cDNA_LOC214292, sequence:GTCCTGAAAAGCGTAAGGGGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13019 same embryo
 EMAGE:13023 same embryo
 EMAGE:13022 same embryo
 EMAGE:13020 same embryo
 EMAGE:13021 same embryo
 EurExpress:euxassay_013694 same experiment
 MGI:4825105 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS