Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13019

Tmem151b transmembrane protein 151B ( MGI:2685169)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13019 EMAGE:13019 EMAGE:13019 EMAGE:13019 EMAGE:13019
"Pseudo-wholemount" of euxassay_013648. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013648_01 euxassay_013648_02 euxassay_013648_03 euxassay_013648_04
EMAGE:13019 EMAGE:13019 EMAGE:13019 EMAGE:13019 EMAGE:13019
euxassay_013648_05 euxassay_013648_06 euxassay_013648_07 euxassay_013648_08 euxassay_013648_09
EMAGE:13019 EMAGE:13019 EMAGE:13019 EMAGE:13019 EMAGE:13019
euxassay_013648_10 euxassay_013648_11 euxassay_013648_12 euxassay_013648_13 euxassay_013648_14
EMAGE:13019 EMAGE:13019 EMAGE:13019 EMAGE:13019 EMAGE:13019
euxassay_013648_15 euxassay_013648_16 euxassay_013648_17 euxassay_013648_18 euxassay_013648_19
EMAGE:13019 EMAGE:13019 EMAGE:13019 EMAGE:13019 EMAGE:13019
euxassay_013648_20 euxassay_013648_21 euxassay_013648_22 euxassay_013648_23 euxassay_013648_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13019Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13019_wholemount_strong.wlz
13019_wholemount_moderate.wlz
13019_wholemount_weak.wlz
13019_wholemount_possible.wlz
13019_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13019_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
liver lobe
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37793
Entity Detected:Tmem151b, transmembrane protein 151B ( MGI:2685169)
Sequence:sense strand is shown

>T37793
GGACCCTTCTGTGTTTATCTCGGGTTGCTGGTTCCCATCTCTGTCTCTTCCCGATACATTCCTGTCTGCC
ACCCCGGTGCTGGTCTACTGTCTCTCCATCTCTGTTCACCTCTGTGCTGGCTCCCGCCTCCTCACCTTGG
CATGCCCTCCCTTCTCATCCGAGCAGCAGCGGCCCATCCAGCCCTCTTTCACCAAATCTCTCTGCCGGGA
GTCTCACTGGAAGTGCCTCCTGCTCTCCCTGCTCATGTACGGCTGCCTGGGGGCAGTGGCCTGGTGCCAC
GTCACCACAGTGACGCGCCTCACCTTCAGCAGCGCCTACCAGGGCAATAGCCTCATGTACCACGACAGCC
CCTGCTCCAACGGCTACGTCTACATCCCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88186. Forward Primer - name:088186_F_cDNA_LOC210573, sequence:GGACCCTTCTGTGTTTATCTCG; Reverse Primer - name:088186_N_SP6_cDNA_LOC210573, sequence:GGGGATGTAGACGTAGCCGTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13023 same embryo
 EMAGE:13022 same embryo
 EMAGE:13020 same embryo
 EMAGE:13018 same embryo
 EMAGE:13021 same embryo
 EurExpress:euxassay_013648 same experiment
 MGI:4828781 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS