EMAGE mouse gene expression spatial database

EMAGE:14604

Mrpl33 mitochondrial ribosomal protein L33 ( MGI:2137225)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_005474. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_005474_01	euxassay_005474_02	euxassay_005474_03	euxassay_005474_04

euxassay_005474_05	euxassay_005474_06	euxassay_005474_07	euxassay_005474_08	euxassay_005474_09

euxassay_005474_10	euxassay_005474_11	euxassay_005474_12	euxassay_005474_13	euxassay_005474_14

euxassay_005474_15	euxassay_005474_16	euxassay_005474_17	euxassay_005474_18	euxassay_005474_19

euxassay_005474_20	euxassay_005474_21	euxassay_005474_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T9840
Entity Detected:	Mrpl33, mitochondrial ribosomal protein L33 ( MGI:2137225)
Sequence:	sense strand is shown >T9840 AGGCGGGTCTCGGTGAGAATCGGTGGACCATGCTGCTCTCCGCTGTCTCTTTTGCCAAGAGCAAGTCAAA AACTATCCTGGTGAAACTAGTGAGCCAAGCTGGGACAGGTTTCTCCTTCAACCACAAGAGAAGCCGACTC CGAGAGAAGCTGAGCCTTCTGCACTATGATCCAATAGTGAACAAAAAAGTTCTCTTTGTGGAACAGAAAA AAATCCGTTCCCTCTGAGTAGTGGATTGAAAATGAATTTGATTCCTAAATGAGAAGCTCGAGGGTGAGGC ACCGTTTCGAACTCTGCAGTGTGCAATGAAGACGAGGAAGTTCCAGCATGGCCTCGGGGGATGTTGGCTA AGGGACAGAGCCGAAAGAGTCCTTCACAGAGACCACATATTTATCTCCCTGGATGCTTTATAGGCCTTAA TAAAAAAATATCAAAATAGTCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:6772871 using vector (pDNR-LIB) specific primers. Forward Primer - name:M13 forward (-21), sequence:TGTAAAACGACGGCCAGT; Reverse Primer - name:T3-pDNR-LIB rv, sequence:CAAATTAACCCTCACTAAAGGGTGTTCACTTACCTACTGGGC. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:6772871 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:14607 same embryo
	EMAGE:14609 same embryo
	EMAGE:14606 same embryo
	EMAGE:14605 same embryo
	EMAGE:14608 same embryo
	EurExpress:euxassay_005474 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source