Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16821

Tifa TRAF-interacting protein with forkhead-associated domain ( MGI:2182965)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16821 EMAGE:16821 EMAGE:16821 EMAGE:16821 EMAGE:16821
"Pseudo-wholemount" of euxassay_008615. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008615_01 euxassay_008615_02 euxassay_008615_03 euxassay_008615_04
EMAGE:16821 EMAGE:16821 EMAGE:16821 EMAGE:16821 EMAGE:16821
euxassay_008615_05 euxassay_008615_06 euxassay_008615_07 euxassay_008615_08 euxassay_008615_09
EMAGE:16821 EMAGE:16821 EMAGE:16821 EMAGE:16821 EMAGE:16821
euxassay_008615_10 euxassay_008615_11 euxassay_008615_12 euxassay_008615_13 euxassay_008615_14
EMAGE:16821 EMAGE:16821 EMAGE:16821 EMAGE:16821
euxassay_008615_15 euxassay_008615_16 euxassay_008615_17 euxassay_008615_18

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16821Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16821_wholemount_strong.wlz
16821_wholemount_moderate.wlz
16821_wholemount_weak.wlz
16821_wholemount_possible.wlz
16821_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16821_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 10
pons ventricular layer
strong strong
regionalstrong expression: see section 07 08 10 11 12
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 13 14 15 16 17 18
midgut
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
liver
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2814
Entity Detected:Tifa, TRAF-interacting protein with forkhead-associated domain ( MGI:2182965)
Sequence:sense strand is shown

>T2814
TGGCCTCGAGGCCAGATTCGGCACGAGGAAAGGGCTGGACGGCGGCGGCAGCCTCTTGCCTGGCTCTGCG
GGGCTTTCCTCCCGGCAAGGGCTTTGCCGAGGTCACTCGCGCGAGGCCGCTCTTGGCGCGCCCGTGGGAG
GCTCGGTGGCGTGGGAGGACCAGCGACCTGCGGATTTCCTCGAGCTCCCACGGCGCTGGCAGCGACGGTC
CCCCACCCCCACCCCTATCCCCAGGCTTCCACCAGAAGGCTCCGCAAGACTCACGGACCTCCAAGTCCCC
AGGAGAGGAGACAAGGCTCAGGAGTCCTGATCTAGCTGTGGCCACTGGAAGACTCTCAGGCCGGGGAGCG
TCATGTCCACCTTTGAAGACGCTGATACAGAGGAGACGGTCACTTGTCTCCAGATGACCATTTACCATCC
TGGCCAACAAAGTGGGATATTTAAATCAATAAGGTTTTGCAGCAAAGAGAAGTTTCCTTCCATTGAAGTG
GTGAAATTTGGACGCAATTCCAACATGTGCCAGTATACGTTTCAGGACAAACAGGTGTCCCGAATTCAGT
TTGTTTTACAGCCGTTTAA
Notes:The probe template was PCR amplified from IMAGE:1528121 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1528121 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16818 same embryo
 EMAGE:16819 same embryo
 EMAGE:16820 same embryo
 EMAGE:16817 same embryo
 EMAGE:16822 same embryo
 EurExpress:euxassay_008615 same experiment
 MGI:4828715 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS