Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18216

Vtn vitronectin ( MGI:98940)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18216 EMAGE:18216 EMAGE:18216 EMAGE:18216 EMAGE:18216
"Pseudo-wholemount" of euxassay_012003. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012003_01 euxassay_012003_02 euxassay_012003_03 euxassay_012003_04
EMAGE:18216 EMAGE:18216 EMAGE:18216 EMAGE:18216 EMAGE:18216
euxassay_012003_05 euxassay_012003_06 euxassay_012003_07 euxassay_012003_08 euxassay_012003_09
EMAGE:18216 EMAGE:18216 EMAGE:18216 EMAGE:18216 EMAGE:18216
euxassay_012003_10 euxassay_012003_11 euxassay_012003_12 euxassay_012003_13 euxassay_012003_14
EMAGE:18216 EMAGE:18216 EMAGE:18216 EMAGE:18216 EMAGE:18216
euxassay_012003_15 euxassay_012003_16 euxassay_012003_17 euxassay_012003_18 euxassay_012003_19
EMAGE:18216 EMAGE:18216 EMAGE:18216 EMAGE:18216 EMAGE:18216
euxassay_012003_20 euxassay_012003_21 euxassay_012003_22 euxassay_012003_23 euxassay_012003_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18216Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18216_wholemount_strong.wlz
18216_wholemount_moderate.wlz
18216_wholemount_weak.wlz
18216_wholemount_possible.wlz
18216_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18216_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hip
weak weak
regionalweak expression: see section 09 10 16
pancreas
strong strong
regionalstrong expression: see section 07 08 moderate expression: see section 06
diencephalon meninges
strong strong
regionalstrong expression: see section 05 06 07 08 10 11 12 13 14 15 16 moderate expression: see section 09
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 10 11 12 13 14 15 16 moderate expression: see section 09 17 18 19 20 21 22 23
hindbrain meninges
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 10 11 12 13 14 15 16 moderate expression: see section 09 17 18 19
metencephalon floor plate
strong strong
regionalstrong expression: see section 10 11
midbrain meninges
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 10 11 12 13 14 15 16 moderate expression: see section 09 17
spinal cord floor plate
strong strong
regionalstrong expression: see section 11 12
spinal cord meninges
strong strong
regionalstrong expression: see section 07 08 10 11 12 13 14 moderate expression: see section 09
meckel's cartilage
weak weak
regionalweak expression: see section 04 06 12 13 14 15 16 17
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 weak expression: see section 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30081
Entity Detected:Vtn, vitronectin ( MGI:98940)
Sequence:sense strand is shown

>T30081
TGCCGACTACATGGAGCAGTGCAAGCCCCAAGTAACGCGGGGGGACGTGTTCACTATGCCAGAGGATGAT
TATTGGAGCTATGACTACGTGGAGGAGCCCAAGAACAATACCAACACCGGTGTGCAACCCGAGAACACCT
CTCCACCCGGTGACCTAAATCCTCGGACGGACGGCACTCTAAAGCCGACAGCCTTCCTAGATCCTGAGGA
ACAGCCAAGCACCCCAGCGCCTAAAGTGGAGCAACAGGAGGAGATCCTAAGGCCCGACACCACTGATCAA
GGGACCCCTGAGTTTCCAGAGGAAGAACTGTGCAGTGGAAAGCCCTTTGACGCCTTCACGGATCTCAAGA
ATGGGTCCCTCTTTGCCTTCCGAGGGCAGTACTGCTATGAGCTAGATGAGACGACAGTGAGGCCTGGGTA
CCCCAAACTTATCCAAGATGTCTGGGGCATTGAGGGCCCCATCGATGCTGCCTTCACTCGCATCAACTGT
CAGGGGAAGACCTACTTGTTCAAGGGTAGTCAGTACTGGCGCTTTGAGGATGGGGTCCTGGACCCTGGTT
ATCCCCGAAACATCTCCGAAGGCTTCAGTGGCATACCAGACAATGTTGATGCAGCGTTCGCCCTTCCTGC
CCACCGTTACAGTGGCCGGGAAAGGGTCTACTTCTTCAAGGGGAAGCAGTACTGGGAGTACGAATTTCAG
CAGCAACCCAGCCAGGAGGAGTGCGAAGGCAGCTCTCTGTCAGCCGTGTTTGAGCACTTTGCCTTGCTTC
AGCGGGACAGCTGGGAGAACATTTTCGAACTCCTCTTCTGGGGCAGATCCTCTGATGGAGCCAGAGAACC
CCAATTCATCAGCCGGAACTGGCATGGTGTGCCAGGGAAAGTGGACGCTGCTATGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4193767), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 9119. Forward Primer - name:009119_F_IRAV20-23_H18_Vtn, sequence:TGCCGACTACATGGAGCA; Reverse Primer - name:009119_R_SP6_IRAV20-23_H18_Vtn, sequence:GCCATAGCAGCGTCCACT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18217 same embryo
 EMAGE:18218 same embryo
 EMAGE:18220 same embryo
 EMAGE:18215 same embryo
 EMAGE:18219 same embryo
 EurExpress:euxassay_012003 same experiment
 MGI:4829181 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS