Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20265

Ctxn1 cortexin 1 ( MGI:88566)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20265 EMAGE:20265 EMAGE:20265 EMAGE:20265 EMAGE:20265
"Pseudo-wholemount" of euxassay_012409. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012409_01 euxassay_012409_02 euxassay_012409_03 euxassay_012409_04
EMAGE:20265 EMAGE:20265 EMAGE:20265 EMAGE:20265 EMAGE:20265
euxassay_012409_05 euxassay_012409_06 euxassay_012409_07 euxassay_012409_08 euxassay_012409_09
EMAGE:20265 EMAGE:20265 EMAGE:20265 EMAGE:20265 EMAGE:20265
euxassay_012409_10 euxassay_012409_11 euxassay_012409_12 euxassay_012409_13 euxassay_012409_14
EMAGE:20265 EMAGE:20265 EMAGE:20265 EMAGE:20265 EMAGE:20265
euxassay_012409_15 euxassay_012409_16 euxassay_012409_17 euxassay_012409_18 euxassay_012409_19
EMAGE:20265 EMAGE:20265
euxassay_012409_20 euxassay_012409_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20265Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20265_wholemount_strong.wlz
20265_wholemount_moderate.wlz
20265_wholemount_weak.wlz
20265_wholemount_possible.wlz
20265_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20265_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 09 11 12 13 14 15 weak expression: see section 08 10 16
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 11 12 13 14 15 weak expression: see section 08 10 16 17
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 11 12 13 14 15 18 20 21 weak expression: see section 07 08 09 10 16 17 19
not examined not examined
regionalnot examined expression: see section 10
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 09 10 11 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 08
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 09 10 12 14 17 18 19 weak expression: see section 06 07 08 15 16
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 09 10 12 14 17 18 weak expression: see section 06 07 08 15 16
pons mantle layer
weak weak
regionalweak expression: see section 07 16
midbrain mantle layer
strong strong
regionalstrong expression: see section 11 12 13 14 15 moderate expression: see section 07 08 09 10 weak expression: see section 16 17
midbrain marginal layer
moderate moderate
regionalmoderate expression: see section 06
facial vii ganglion
strong strong
regionalstrong expression: see section 03 05 06 18 19 moderate expression: see section 04
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 17 moderate expression: see section 16
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 15
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 17 moderate expression: see section 05 07 16
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08 15 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 13 weak expression: see section 11 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 13 14 15 moderate expression: see section 08 09 16
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 20 21
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 13 14 moderate expression: see section 07 08 15 16 17
vomeronasal organ
strong strong
regionalstrong expression: see section 11 14
stomach
weak weak
regionalweak expression: see section 02 03 04 05 06 07
midgut
weak weak
regionalweak expression: see section 06 07
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31289
Entity Detected:Ctxn1, cortexin 1 ( MGI:88566)
Sequence:sense strand is shown

>T31289
TCGGCGTGGACACTATCACCGGAGCCGCTGCCGCCGTCGACGGGGCCCCCGGTGGGCGCGGGCCTGGACG
TCGAGCAACGCACGGTGTTCGCCTTCGTGCTCTGCCTGCTCGTGGTGTTGGTTCTGTTGATGGTGCGCTG
TGTGCGCATACTGCTAGACCCCTACAGCCGCATGCCCGCCTCGTCCTGGACCGACCACAAGGAGGCGCTC
GAACGCGGGCAGTTCGACTATGCGTTGGTGTGATGGGGAACCAGTCGGGGCAGGTCCTTAGGGTCATCCC
CGTGGAGGGGTGCCACCAGCCTGGACTGTGCTCAGGGTTATGCCTAGATGCCCTAGCTCGAAGTTGAGGG
CGTTCGGAGAAGTCCAGTCCTTACCTACCTTAGCTACCCATCTTCCTTCCTGGCCAGGCCAGAACCCCAC
CTGGTGCCTTTATCTACCCTGTCCCCTTCTCTCTACATACTTATCCTCATTGCTGATCCCTCAACACTGA
GTCCCTGGTGAGTGAAGGACCCCGCACCAACCTCAGCTTTCCCCAACTACCAGGCATGCTACATTCTTTC
CTGGAAATGCGGACACCTCTTATCTCTTATTTCTTTGTTATGGTCATCCTCAATTTCAGTGCACTCCTTG
AGTCCTGGCCCTGGCAGGCAGGCTTTCTTCGACTCACATTGGACGCTGCCTACCTATAATGCACGGTACA
GTTTGCCTCAGAGACAGACCCAGAAACCCCACCATGGCTGCTGCTTGTGTTGATAATATCTGGCACTTTA
TGTGCGGGAGTACAAGCAGGCTCATCCCCTTCCCAGACTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4224851), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 55800. Forward Primer - name:055800_F_IRAV50_h02_Ctxn, sequence:TCGGCGTGGACACTATCA; Reverse Primer - name:055800_R_SP6_IRAV50_h02_Ctxn, sequence:CGAGTCTGGGAAGGGGAT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20266 same embryo
 EMAGE:20268 same embryo
 EMAGE:20269 same embryo
 EMAGE:20267 same embryo
 EurExpress:euxassay_012409 same experiment
 MGI:4824120 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS