EMAGE mouse gene expression spatial database

EMAGE:20266

Eci3 enoyl-Coenzyme A delta isomerase 3 ( MGI:1916373)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_012322. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_012322_01	euxassay_012322_02	euxassay_012322_03	euxassay_012322_04

euxassay_012322_05	euxassay_012322_06	euxassay_012322_07	euxassay_012322_08	euxassay_012322_09

euxassay_012322_10	euxassay_012322_11	euxassay_012322_12	euxassay_012322_13	euxassay_012322_14

euxassay_012322_15	euxassay_012322_16	euxassay_012322_17	euxassay_012322_18	euxassay_012322_19

euxassay_012322_20	euxassay_012322_21	euxassay_012322_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T31261
Entity Detected:	Eci3, enoyl-Coenzyme A delta isomerase 3 ( MGI:1916373)
Sequence:	sense strand is shown >T31261 AAGAGTACGCGGTGCTGGTGTCCTAGGCCACAGAAGGACCCTGTAATATGCCTAAGCCTGGTGTGTTTAA CTTTGTCAACAAAGCCACGTGGGATGCAAGAAATGCCCTGGGCAGCCTACCCAAGGAAACTGCCAGGAAG AACTATGTGGATCTCGTATCCAGTTTGAGTTCCTCATCTGAAGCCCCGAGCCAGGGAAAGCGTGGAGCTG ATGAGAAAGCCCGGGAGTCCAAAGACATCCTGGTAACTTCTGAAGATGGCATCACAAAGATCACGTTCAA TCGGCCCACCAAAAAGAATGCCATATCCTTCCAGATGTATCTGGATATTATGCATGCACTTAAAAATGCC AGCACGGATAACTCAGTCATAACTGTTTTCACAGGAACTGGTGACTACTACAGCAGTGGGAATGACCTAA AAAACTTGATTAATGACGCTGGTGAAATACAG
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4219360), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 55710. Forward Primer - name:055710_F_IRAV49_e08_1810022C23Rik, sequence:AAGAGTACGCGGTGCTGG; Reverse Primer - name:055710_R_SP6_IRAV49_e08_1810022C23Rik, sequence:CCTGTATTTCACCAGCGTCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:20268 same embryo
	EMAGE:20269 same embryo
	EMAGE:20265 same embryo
	EMAGE:20267 same embryo
	EurExpress:euxassay_012322 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source