Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20725

Begain brain-enriched guanylate kinase-associated ( MGI:3044626)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20725 EMAGE:20725 EMAGE:20725 EMAGE:20725 EMAGE:20725
"Pseudo-wholemount" of euxassay_014034. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014034_01 euxassay_014034_02 euxassay_014034_03 euxassay_014034_04
EMAGE:20725 EMAGE:20725 EMAGE:20725 EMAGE:20725 EMAGE:20725
euxassay_014034_05 euxassay_014034_06 euxassay_014034_07 euxassay_014034_08 euxassay_014034_09
EMAGE:20725 EMAGE:20725 EMAGE:20725 EMAGE:20725 EMAGE:20725
euxassay_014034_10 euxassay_014034_11 euxassay_014034_12 euxassay_014034_13 euxassay_014034_14
EMAGE:20725 EMAGE:20725 EMAGE:20725 EMAGE:20725 EMAGE:20725
euxassay_014034_15 euxassay_014034_16 euxassay_014034_17 euxassay_014034_18 euxassay_014034_19
EMAGE:20725 EMAGE:20725
euxassay_014034_20 euxassay_014034_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20725Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20725_wholemount_strong.wlz
20725_wholemount_moderate.wlz
20725_wholemount_weak.wlz
20725_wholemount_possible.wlz
20725_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20725_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
strong strong
single cellstrong expression: see section 04 05 06 07 08 09 10 11 12 14 15 16 17 19 20 21
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
pons mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 14 15 16 17 18
midbrain mantle layer
strong strong
single cellstrong expression: see section 07 08 09 11 12 13 14 15 16 17
ventral grey horn
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 13 14
cornea
weak weak
regionalweak expression: see section 01 02 03 04
neural retina
weak weak
regionalweak expression: see section 02 03
lower lip
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 13 14 15 16
upper lip
weak weak
regionalweak expression: see section 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39813
Entity Detected:Begain, brain-enriched guanylate kinase-associated ( MGI:3044626)
Sequence:sense strand is shown

>T39813
GCACTATGAGGAAGAGAAGCGTGCCATGAGCCATGAGATTGTCGCCCTCAACAGCCACCTGCTGGAGGCT
AAGGTGACCATTGACAAGCTGTCGGAGGACAACGAGCTCTATAGGAAGGACTGCAATCTAGCGGCCCAGC
TGCTGCAGTGCAGCCAGACCTACGGCAGGGTCCATAAGGTGTCCGAGGTAACGTGGCCCCGCCCCACAGC
CAGGCCCGCCCCGTCCCAGGACCACCCGGCTCCTTTGGGGCCACCCCACCCCGAAGCCTCTCCCCACCCT
CCAGGAAGAAGCTACCCGCTGCCCTCGGACTTCCAACAGCGCGTGAGCCTGCACATGGAGAAGCATGGCT
GCAGCCTGCCGTCCGCACTGTGCCATCCGGCCTACGCCGACAGCGTGCCCACCTGCGTCATCGCCAAAGT
GCTGGAGAAGCCGGACCCGGGCAGCCTGTCCTCGCGCATGTCGGATGCCTCGGCCCGCGACCTGGGCTAC
CGCGACGGAGTGGAGAAGTCGGGCCCGCGGCCCCCGTACAAGGGAGACATCTACTGCAGCGACCCAGCTC
TCTACTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 83886. Forward Primer - name:083886_F_cDNA_BM948371, sequence:GCACTATGAGGAAGAGAAGCGT; Reverse Primer - name:083886_N_SP6_cDNA_BM948371, sequence:CAGTAGAGAGCTGGGTCGCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20721 same embryo
 EMAGE:20720 same embryo
 EMAGE:20724 same embryo
 EMAGE:20722 same embryo
 EMAGE:20723 same embryo
 EurExpress:euxassay_014034 same experiment
 MGI:4823458 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS