Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29339

Defb12 ( MGI:1924924)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:29339 EMAGE:29339 EMAGE:29339 EMAGE:29339 EMAGE:29339
euxassay_009570_01 euxassay_009570_02 euxassay_009570_03 euxassay_009570_04 euxassay_009570_05
EMAGE:29339 EMAGE:29339 EMAGE:29339 EMAGE:29339 EMAGE:29339
euxassay_009570_06 euxassay_009570_07 euxassay_009570_08 euxassay_009570_09 euxassay_009570_10
EMAGE:29339 EMAGE:29339 EMAGE:29339 EMAGE:29339 EMAGE:29339
euxassay_009570_11 euxassay_009570_12 euxassay_009570_13 euxassay_009570_14 euxassay_009570_15
EMAGE:29339 EMAGE:29339 EMAGE:29339 EMAGE:29339 EMAGE:29339
euxassay_009570_16 euxassay_009570_17 euxassay_009570_18 euxassay_009570_19 euxassay_009570_20
EMAGE:29339 EMAGE:29339 EMAGE:29339 EMAGE:29339
euxassay_009570_21 euxassay_009570_22 euxassay_009570_23 euxassay_009570_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36280
Entity Detected:Defb12, ( MGI:1924924)
Sequence:sense strand is shown

>T36280
AAGCAGACACAACTGCACAACTCCAGAACACTCATAACTTATAACTGTTCTTTCCAGAATTGTCTCATAG
GGCTCAGGGTCACCTGAGAGTGTGACTATCATCCTTATTTGTATTTGATACAGGTATTTTATTTGTATTG
TCGTCTGTAGTACAGCAAACCTGGGAGACAAGGGACAGTGTGGGCATCACTACCTCTTTCTGTGTCTCTA
ACATACTAATTATTATGGGATTAATAGACAAACGAAAGTGCTATGCTCCTCTATGTTGACAGCTTTGTAG
TTCTATAGACTACAAGAAAAAATGCATTCCTTTGATTCTTGATGAGGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 66977. Forward Primer - name:066977_F_cDNA_Defb12, sequence:AAGCAGACACAACTGCACAACT; Reverse Primer - name:066977_N_SP6_cDNA_Defb12, sequence:CACCTCATCAAGAATCAAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009570 same experiment
 EMAGE:31081 same embryo
 EMAGE:30910 same embryo
 EMAGE:31096 same embryo
 EMAGE:30919 same embryo
 EMAGE:30832 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS