Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31096

Dgkb ( MGI:2442474)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31096 EMAGE:31096 EMAGE:31096 EMAGE:31096 EMAGE:31096
euxassay_009581_01 euxassay_009581_02 euxassay_009581_03 euxassay_009581_04 euxassay_009581_05
EMAGE:31096 EMAGE:31096 EMAGE:31096 EMAGE:31096 EMAGE:31096
euxassay_009581_06 euxassay_009581_07 euxassay_009581_08 euxassay_009581_09 euxassay_009581_10
EMAGE:31096 EMAGE:31096 EMAGE:31096 EMAGE:31096 EMAGE:31096
euxassay_009581_11 euxassay_009581_12 euxassay_009581_13 euxassay_009581_14 euxassay_009581_15
EMAGE:31096 EMAGE:31096 EMAGE:31096 EMAGE:31096 EMAGE:31096
euxassay_009581_16 euxassay_009581_17 euxassay_009581_18 euxassay_009581_19 euxassay_009581_20
EMAGE:31096
euxassay_009581_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
strong strong
single cellstrong expression: see section 09 10 14 15
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 05 07 08 09 15 16
anterior abdominal wall musculature
moderate moderate
regionalmoderate expression: see section 01 02 05 06 07 08 09 10 11 15 16 17 18 19 20 21 weak expression: see section 03 12
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 20 21 weak expression: see section 06 07 08 09 10 11 17 18 19
olfactory cortex ventricular layer
weak weak
regionalweak expression: see section 10 11 12 17 18
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 10 11 14 15
medulla oblongata alar plate mantle layer
strong strong
single cellstrong expression: see section 09 13 14
pons mantle layer
strong strong
single cellstrong expression: see section 03 04 05 06 07 08 09 10 11 13 14 15 17
diencephalon lateral wall ventricular layer
strong strong
single cellstrong expression: see section 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36281
Entity Detected:Dgkb, ( MGI:2442474)
Sequence:sense strand is shown

>T36281
GTGTCTCTGGAGGAGTGGATTCAAGGAGGAATGACAACTATCCCACTTCTAGTCCTGCTGGGCTTGGAGA
ATAATGTGAAGGATGATGGACAGCATGTGTGGCGACTCAAGCACTTTAACAAGCCTGCCTACTGCAATCT
CTGCCTGAACATGCTGATTGGCGTGGGGAAGCAGGGCCTCTGCTGCTCCTTCTGCAAGTACACGGTCCAT
GAGCGCTGTGTGGCCAGAGCCCCGCCCTCCTGCATCAAGACATATGTGAAGTCCAAGAAAAACACAGACG
TCATGCACCACTATTGGGTCGAAGGCAATTGCCCAACCAAGTGCGATAAGTGCCACAAAACAGTGAAATG
TTACCAGGGCCTGACGGGCCTGCATTGTGTTTGGTGCCAGACCACACTGCACAATAAATGTGCTTCTCAT
CTGAAGCCCGAGTGTGACTGTGGACCCTTGAAGGACCATATTTTGCCACCTACCACAATCTGTCCAGTTG
TATTGACTATGCCCAGTGCTGGAGCCTCAGTTCCTGAGGAAAGACAGTCCACAGCTAAAAAGGAAAAGAG
CAGCTCCCAGCAGCCAAATAAAGCAACAGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 70777. Forward Primer - name:070777_F_cDNA_Dgkb, sequence:GTGTCTCTGGAGGAGTGGATTC; Reverse Primer - name:070777_N_SP6_cDNA_Dgkb, sequence:GTCTGTTGCTTTATTTGGCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009581 same experiment
 EMAGE:31081 same embryo
 EMAGE:30910 same embryo
 EMAGE:30919 same embryo
 EMAGE:30832 same embryo
 EMAGE:29339 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS