EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29653

Pes1 ( MGI:1890613)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_009264_01	euxassay_009264_02	euxassay_009264_03	euxassay_009264_04	euxassay_009264_05

euxassay_009264_06	euxassay_009264_07	euxassay_009264_08	euxassay_009264_09	euxassay_009264_10

euxassay_009264_11	euxassay_009264_12	euxassay_009264_13	euxassay_009264_14	euxassay_009264_15

euxassay_009264_16	euxassay_009264_17	euxassay_009264_18	euxassay_009264_19	euxassay_009264_20

euxassay_009264_21	euxassay_009264_22	euxassay_009264_23	euxassay_009264_24

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T582
Entity Detected:	Pes1, ( MGI:1890613)
Sequence:	sense strand is shown >T582 TCCTCGAGNCTGTTGGCCTACTGGACGTGCGGGAGGAAGTAGCTCTGGTGTTCTGGCTGCCTTGAATTTC TCAACGTGGAGCTATGGGAGGTCTGGAGAAGAAGAAGTATGAACGAGGCTCTGCCACCAATTATATCACC CGAAACAAGGCCAGGAAGAAGCTGCAGCTGAGCCTGCCTGACTTCAGGCGGCTGTGCATCCTGAAAGGTA TTTATCCTCACGAACCCAAGCATAAGAAGAAAGTTAACAAGGGTTCCACAGCAGCCCGGACATTTTACCT TATCAAAGACATTAAATTCCTCCTCCATGAGCCCATCGTCAACAAGTTCCGAGAGTACAAGGTGTTTGTT CGGAAGCTCCGCAAAGCCTATGGAAAGAGCGAATGGAATGCTGTGGAGCGCCTGAAGGACAATAAACCCT GCTACAAACTTGACCACATTGTCAAGGAGCGGTACCCCACATTTATCGATGCTCTGCGGGACCTCGATGA TGCCCTGTCAATGTGCTTCCTCTTCTCCACCTTCCCTCGGACTGGCAAGTGTCATGTGCAGACCATTCAG TT
Notes:	The probe template was PCR amplified from IMAGE:1885292 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1885292 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_009264 same experiment
	EMAGE:31292 same embryo
	EMAGE:31614 same embryo
	EMAGE:31682 same embryo
	EMAGE:31545 same embryo
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source