Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31614

Ric8 resistance to inhibitors of cholinesterase 8 homolog (C. elegans) ( MGI:2141866)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31614 EMAGE:31614 EMAGE:31614 EMAGE:31614 EMAGE:31614
euxassay_005025_01 euxassay_005025_02 euxassay_005025_03 euxassay_005025_04 euxassay_005025_05
EMAGE:31614 EMAGE:31614 EMAGE:31614 EMAGE:31614 EMAGE:31614
euxassay_005025_06 euxassay_005025_07 euxassay_005025_08 euxassay_005025_09 euxassay_005025_10
EMAGE:31614 EMAGE:31614 EMAGE:31614 EMAGE:31614 EMAGE:31614
euxassay_005025_11 euxassay_005025_12 euxassay_005025_13 euxassay_005025_14 euxassay_005025_15
EMAGE:31614 EMAGE:31614 EMAGE:31614 EMAGE:31614 EMAGE:31614
euxassay_005025_16 euxassay_005025_17 euxassay_005025_18 euxassay_005025_19 euxassay_005025_20
EMAGE:31614 EMAGE:31614
euxassay_005025_21 euxassay_005025_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
strong strong
regionalstrong expression: see section 01 02 19 20 21
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 15
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 07 moderate expression: see section 12
spinal cord
strong strong
homogeneousstrong expression: see section 08 09 10 11 12 13
brain
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06
trigeminal v nerve
strong strong
regionalstrong expression: see section 14
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11
dorsal root ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14
facial vii ganglion
strong strong
regionalstrong expression: see section 04 16 17
not examined not examined
regionalnot examined expression: see section 01 02 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 06 14
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 14 15 16 17 18
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 11 12 13 14
cervical ganglion
strong strong
regionalstrong expression: see section 07 moderate expression: see section 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T584
Entity Detected:Ric8, resistance to inhibitors of cholinesterase 8 homolog (C. elegans) ( MGI:2141866)
Sequence:sense strand is shown

>T584
CCTCGAGNCTGTTGGCCTACTGGCGGACCTGGGCGGAGCCCCGGGGTTTGGCCGATTGCGTCTTCCCAGC
CCAAGCCTTCCAGCACCCGGTGCCAGGGGCCATGGAGCCCCGGGCAGTTGCGGATGCCTTGGAGACCGGA
GAGGAAGATGCGGTGACAGAAGCTCTGCGGTCGTTCAACCGGGAGCATTCTCAGAGCTTCACCTTCGATG
ATGCCCAGCAGGAGGACAGGAAGAGACTCGCAAAGCTACTGGTCTCCGTCCTGGAGCAGGGCTTGTCACC
AAAGCACCGTGTCACCTGGCTGCAGACTATCCGAATCCTATCCCGAGACCGCAGCTGCCTGGACTCATTT
GCCAGCCGCCAGAGCTTACATGCACTAGCCTGCTATGCTGACATTACCGTCTCAGAGGAACCCATCCCAC
AGTCCCCAGACATGGATGTCCTCCTCGAGTCTCTCAAATGCCTGTGTAATCTTGTGCTCAGCAGTCCAAC
AGCACAGATGCTAGCAGCAGAGGCTCGCCTGGTGGTGAGGCTAGCGGAGCGTGT
Notes:The probe template was PCR amplified from IMAGE:1885401 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1885401 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005025 same experiment
 EMAGE:31292 same embryo
 EMAGE:31682 same embryo
 EMAGE:29653 same embryo
 EMAGE:31545 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS