Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29681

Rps17 ( MGI:1309526)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:29681 EMAGE:29681 EMAGE:29681 EMAGE:29681 EMAGE:29681
euxassay_009236_01 euxassay_009236_02 euxassay_009236_03 euxassay_009236_04 euxassay_009236_05
EMAGE:29681 EMAGE:29681 EMAGE:29681 EMAGE:29681 EMAGE:29681
euxassay_009236_06 euxassay_009236_07 euxassay_009236_08 euxassay_009236_09 euxassay_009236_10
EMAGE:29681 EMAGE:29681 EMAGE:29681 EMAGE:29681 EMAGE:29681
euxassay_009236_11 euxassay_009236_12 euxassay_009236_13 euxassay_009236_14 euxassay_009236_15
EMAGE:29681 EMAGE:29681 EMAGE:29681 EMAGE:29681 EMAGE:29681
euxassay_009236_16 euxassay_009236_17 euxassay_009236_18 euxassay_009236_19 euxassay_009236_20
EMAGE:29681 EMAGE:29681
euxassay_009236_21 euxassay_009236_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1172
Entity Detected:Rps17, ( MGI:1309526)
Sequence:sense strand is shown

>T1172
CTGGGTAATGACTTCCACACCAACAAGCGCGTGTGCGAGGAGATCGCCATTATCCCCAGCAAGAAGCTTC
GGAACAAGATAGCCGGCTATGTCACGCATCTGATGAAGCGGATTCAGAGAGGGCCTGTGAGAGGCATCTC
TATCAAGTTGCAGGAAGAAGAGAGAGAGAGGAGAGATAACTACGTTCCTGAGGTCTCAGCCCTAGATCAG
GAGATCATTGAGGTGGATCCCGACACCAAGGAGATGCTGAAGCTCCTGGACTTTGGCAGTCTCTCTAACC
TTCAGGTCACTCAGCCTACAGTTGGCATGAATTTCAAAACACCACGTGGAGCTGTTTAATCTGTTATGCC
ATATTTTCAATAAACCTGAAAACAAAAAAAAAAAAAAAAAAAAGGCCACAT
Notes:The probe template was PCR amplified from IMAGE:2159091 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2159091 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009236 same experiment
 EMAGE:29736 same embryo
 EMAGE:30971 same embryo
 EMAGE:31734 same embryo
 EMAGE:29679 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS