Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30971

Mrps18c ( MGI:1915985)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30971 EMAGE:30971 EMAGE:30971 EMAGE:30971 EMAGE:30971
euxassay_001893_01 euxassay_001893_02 euxassay_001893_03 euxassay_001893_04 euxassay_001893_05
EMAGE:30971 EMAGE:30971 EMAGE:30971 EMAGE:30971 EMAGE:30971
euxassay_001893_06 euxassay_001893_07 euxassay_001893_08 euxassay_001893_09 euxassay_001893_10
EMAGE:30971 EMAGE:30971 EMAGE:30971 EMAGE:30971 EMAGE:30971
euxassay_001893_11 euxassay_001893_12 euxassay_001893_13 euxassay_001893_14 euxassay_001893_15
EMAGE:30971 EMAGE:30971 EMAGE:30971 EMAGE:30971 EMAGE:30971
euxassay_001893_16 euxassay_001893_17 euxassay_001893_18 euxassay_001893_19 euxassay_001893_20
EMAGE:30971 EMAGE:30971
euxassay_001893_21 euxassay_001893_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 13 moderate expression: see section 05 12
pectoral girdle and thoracic body wall skeleton
strong strong
regionalstrong expression: see section 08 09 10 11 moderate expression: see section 01 02 03 04 05 06 07 12 13 14 15 16 17 18 19 20
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 13 moderate expression: see section 04 05 06 12
inner ear vestibular component
strong strong
regionalstrong expression: see section 02 03 04 05 06 07
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 12
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 13 moderate expression: see section 04 05 07 08 09 12
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 12 13 14 15
axial skeleton
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 12 14
foot mesenchyme
strong strong
regionalstrong expression: see section 14 15 moderate expression: see section 03 16
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 13 moderate expression: see section 04 05 06 07 08 12
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10
submandibular gland primordium
strong strong
regionalstrong expression: see section 04 05 06 07 13 14 15 16
trachea
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 11
basisphenoid bone
strong strong
regionalstrong expression: see section 01 21 moderate expression: see section 20
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 13 moderate expression: see section 04 07 08 09 12
cerebellum intraventricular portion ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 08 11 16 18 19
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 moderate expression: see section 07 08
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 12 moderate expression: see section 06 07 08 09 10 11 13 14 15 16 17 18
lung
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 21 22 moderate expression: see section 02 03 04 05 06 16 17 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2535
Entity Detected:Mrps18c, ( MGI:1915985)
Sequence:sense strand is shown

>T2535
TGGCCTCGAGGCCAGATTCGGCACGAGGAGAACCATGGCCGCTCTGGTTGCTCTGTGCAGTGGTATAGGG
AGGAAGAATTTGACAACCGCGGCTGGCTGCTTCACGGATCGCGGAACTCAAGCAGTTTCTGTGATTTGGA
GACGATGTTTTTCACAGTTTGAACAGGTAACCAGCAATGAGGACCTGCCAGTCCCAATGGAGAACCCCTA
CAAGGAGCCTCTTAAGAAGTGTGTCTTGTGTGAGAAACGTGTAGATTACAAGAATGTGCAGCTTTTGTCC
CAGTTTATTTCTCCATTTACCGGATGCATTTATGGAAGGCACATAACAGGTCTTTGTGGAAAGAAACAGA
GGGAAATAACTAAAGCCATTAAGAGAGCTCAGAAAATGGGGTTTATGCCAGTTACATACAAGGATCCTGC
ATATCTCAAAGACCCTAGAGTTTGTAACATCAGATACCGAGAATAAATTTTGTATTTGTGAAGTTCCTGC
CAATAAACCTCTAAGTGGTTGTCAGCNNAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1382044 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1382044 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001893 same experiment
 EMAGE:29736 same embryo
 EMAGE:29681 same embryo
 EMAGE:31734 same embryo
 EMAGE:29679 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS