EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29840

Gja4 gap junction protein, alpha 4 ( MGI:95715)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_000349_22	euxassay_000349_01	euxassay_000349_02	euxassay_000349_03	euxassay_000349_04

euxassay_000349_05	euxassay_000349_06	euxassay_000349_07	euxassay_000349_08	euxassay_000349_09

euxassay_000349_10	euxassay_000349_11	euxassay_000349_12	euxassay_000349_13	euxassay_000349_14

euxassay_000349_15	euxassay_000349_16	euxassay_000349_17	euxassay_000349_18	euxassay_000349_19

euxassay_000349_20	euxassay_000349_21	euxassay_000349_23

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T3849
Entity Detected:	Gja4, gap junction protein, alpha 4 ( MGI:95715)
Sequence:	sense strand is shown >T3849 TGGCCTCGAGCCAGATTCGGACGAGGTCNCCTGCTGGAGCTGGTTCACCTGCTGTGTCGGTGTGTCAGCC GGGAGATAAAGGCACGAAGGGACCACGACGCCCGCCCGGCCCAGGGCAGTGCCTCAGACCCTTACCCTGA ACAGGTTTTCTTCTACCTCCCCATGGGCGAGGGACCCTCTTCCCCACCGTGTCCCACCTACAACGGGCTC TCATCCACTGAGCAGAACTGGGCCAACTTGACCACAGAGGAGAGACTGACCTCTTCCAGACCTCCCCCAT TTGTAAACACAGCTCCCCAGGGTGGCCGAAAGTCCCCTAGCCGCCCCAACAGCTCTGCATCCAAGAAGCA GTATGTGTAGGGATCTGGGGCTAATGTCACTCAACAGAGCTGCCCCGAGGAGCACGCACGTGTACCTTGG CTGCCTCTCTGGCGGTCCACTCCTCAAAGGCACCTCAGAGACAACTGGGCCAGGGAGGTGGACATTCGCT GGGCAGAGGACCTGGTCACAGATGGTTCTGGAATACCTGGAGCCTTTGTGATGACCAGAGGACACTGGCT
Notes:	The probe template was PCR amplified from IMAGE:422485 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:422485 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_000349 same experiment
	EMAGE:31958 same embryo
	EMAGE:29703 same embryo
	EMAGE:29780 same embryo
	EMAGE:29708 same embryo
	EMAGE:31998 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source