Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31958

Hoxb5 homeobox B5 ( MGI:96186)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31958 EMAGE:31958 EMAGE:31958 EMAGE:31958 EMAGE:31958
euxassay_000381_01 euxassay_000381_02 euxassay_000381_03 euxassay_000381_04 euxassay_000381_05
EMAGE:31958 EMAGE:31958 EMAGE:31958 EMAGE:31958 EMAGE:31958
euxassay_000381_06 euxassay_000381_07 euxassay_000381_08 euxassay_000381_09 euxassay_000381_10
EMAGE:31958 EMAGE:31958 EMAGE:31958 EMAGE:31958 EMAGE:31958
euxassay_000381_11 euxassay_000381_12 euxassay_000381_13 euxassay_000381_14 euxassay_000381_15
EMAGE:31958 EMAGE:31958 EMAGE:31958 EMAGE:31958 EMAGE:31958
euxassay_000381_16 euxassay_000381_17 euxassay_000381_18 euxassay_000381_19 euxassay_000381_20
EMAGE:31958 EMAGE:31958
euxassay_000381_21 euxassay_000381_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
nasal cavity
weak weak
regionalweak expression: see section 12
pectoral girdle and thoracic body wall skeleton
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16
nasal capsule
weak weak
regionalweak expression: see section 08 09 10 11 13 14 15 16 17 18 19 20
axial skeleton
weak weak
regionalweak expression: see section 08 09 11 12 13 14 15 16
dorsal grey horn
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3844
Entity Detected:Hoxb5, homeobox B5 ( MGI:96186)
Sequence:sense strand is shown

>T3844
TTTGAGTTTCTGCTGGAAACTTCCATAAGGGGCAGCAGTTGAGGTTGGGTAGTGCTGGGCCCAGCTGAGC
TGGCCTGGGAAATGGAGCCCACTGTCTGTGTCTCTTTTCTCCCACCTCATCCTTCTTCAGCCCCACCCAG
CCCCCACTCCCTAGGCTCAGGTAGCTTGTTCCTTGGGGTGGGAAGGGAGCTAGGGAAGGGTCAAAGTGTG
GACATTGAGAAGAGGAGAGGAAAGGAGCAAGAGCTGAACTCCTGCTGCCTGGTAGGCCCCACAAGGCCTA
GTCTGGAAGCGTATGGAATCAGAAATAATCCTCAGTGTAAAATGTCTTGTGATTTTTCTCTGTGAATCCG
TGGGTCTGGCTAGAAGGCCCAATGCTGTAAATATGGGGATAGTCTGGGTCAGGCCAATCACTTCCTCTCT
CACCCATTTCGCTTCCAAGACCATTTGTAGTGAGCGGGTGGATGCTGTGCTACGTGTGAAATCTGTCTTT
GCCAGGCCTGTCTCAGTGATTAGCTTTTGGTATGTCTGTAGCTTT
Notes:The probe template was PCR amplified from IMAGE:421728 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:421728 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000381 same experiment
 EMAGE:29703 same embryo
 EMAGE:29780 same embryo
 EMAGE:29708 same embryo
 EMAGE:29840 same embryo
 EMAGE:31998 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS