Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31004

U2af1-rs1 ( MGI:98885)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31004 EMAGE:31004 EMAGE:31004 EMAGE:31004 EMAGE:31004
euxassay_000301_14 euxassay_000301_01 euxassay_000301_02 euxassay_000301_05 euxassay_000301_06
EMAGE:31004 EMAGE:31004 EMAGE:31004 EMAGE:31004 EMAGE:31004
euxassay_000301_08 euxassay_000301_09 euxassay_000301_10 euxassay_000301_11 euxassay_000301_12
EMAGE:31004 EMAGE:31004 EMAGE:31004 EMAGE:31004 EMAGE:31004
euxassay_000301_13 euxassay_000301_15 euxassay_000301_16 euxassay_000301_17 euxassay_000301_18
EMAGE:31004 EMAGE:31004 EMAGE:31004 EMAGE:31004
euxassay_000301_20 euxassay_000301_22 euxassay_000301_23 euxassay_000301_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
weak weak
homogeneousweak expression: see section 18
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 10 weak expression: see section 19
trigeminal v nerve maxillary division
moderate moderate
homogeneousmoderate expression: see section 07
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 04 05 07 09 10 weak expression: see section 06 18 19
trigeminal v nerve mandibular division
moderate moderate
homogeneousmoderate expression: see section 08
liver
moderate moderate
homogeneousmoderate expression: see section 10 15 16 not detected expression: see section 19
vestibulocochlear viii ganglion
moderate moderate
homogeneousmoderate expression: see section 10 weak expression: see section 19
testis
strong strong
single cellstrong expression: see section 08
otic capsule
weak weak
regionalweak expression: see section 05
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1693
Entity Detected:U2af1-rs1, ( MGI:98885)
Sequence:sense strand is shown

>T1693
TGGCCTCGAGCCAGATTCGGCACGAGGCAANAAGCTACCACTCTGGTTCATACCACTCCTCCAAGAGAAA
CAGGGAGTCCGAGAGGAAGAGTCCTCACAGGTGGAAGAAATCTCACAAACAGACAACGAAGAGTCATGAG
AGGCACAGTTCAAGAAGAGGAAGAGAAGAGGACAGCAGTCCAGGTCCACAAAGCCAGAGCCACAGAACCT
GAGCCCAGCTAAGGCAGCACCACTTGGACCCAAGACTGATATCAGGCTTGGCAAGGGAGTTCATTTTACA
AATGAACAAAACTTCATTACAGAATAAAAACCTAACACAGTATCCTTCAGATTCCCCAAAATATTCAAAA
CGAAACTGATTACAAAGGAAAGGCATGGTGACTCCATCTAATTCCCAACCAAGTTACAAAACCTTGTGGC
TTTAAGAAACAGAAACAGGTATTCAGTATTTCTTTGTCTGTTATAATGCTTATAATGCTGTTATAATGCT
TAGTATCATGTTATTGATGTTATTTTCCATACAGTTTAAGCTGGCTTCCCATGTTGTTTTCCTGTAATA
Notes:The probe template was PCR amplified from IMAGE:476501 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:476501 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000301 same experiment
 EMAGE:29318 same embryo
 EMAGE:31935 same embryo
 EMAGE:31904 same embryo
 EMAGE:31045 same embryo
 EMAGE:31940 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS