Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31904

Kcnj16 ( MGI:1314842)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31904 EMAGE:31904 EMAGE:31904 EMAGE:31904 EMAGE:31904
euxassay_000169_01 euxassay_000169_02 euxassay_000169_03 euxassay_000169_04 euxassay_000169_05
EMAGE:31904 EMAGE:31904 EMAGE:31904 EMAGE:31904 EMAGE:31904
euxassay_000169_06 euxassay_000169_07 euxassay_000169_08 euxassay_000169_09 euxassay_000169_10
EMAGE:31904 EMAGE:31904 EMAGE:31904 EMAGE:31904 EMAGE:31904
euxassay_000169_12 euxassay_000169_13 euxassay_000169_14 euxassay_000169_15 euxassay_000169_16
EMAGE:31904 EMAGE:31904 EMAGE:31904 EMAGE:31904 EMAGE:31904
euxassay_000169_17 euxassay_000169_18 euxassay_000169_19 euxassay_000169_20 euxassay_000169_21
EMAGE:31904 EMAGE:31904 EMAGE:31904
euxassay_000169_22 euxassay_000169_23 euxassay_000169_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
midbrain floor plate
strong strong
homogeneousstrong expression: see section 12 13
early nephron
strong strong
homogeneousstrong expression: see section 10 11 12
spinal cord floor plate
strong strong
regionalstrong expression: see section 14
renal cortex
strong strong
homogeneousstrong expression: see section 10 11 12
medulla oblongata floor plate
strong strong
homogeneousstrong expression: see section 13 14
metencephalon floor plate
strong strong
homogeneousstrong expression: see section 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1782
Entity Detected:Kcnj16, ( MGI:1314842)
Sequence:sense strand is shown

>T1782
TGGCCTCGAGGCCAGAATTCGGATCCATGNTTTATTGCATATACCTGTGTCTCCTCTTGAAGGTGAAATA
TTTAGGAGTGTGGGGAAAAGAGGCTGTTAAACTAGATAAATATAGAGAAGCAGATAAGCTAAATATTTGC
ATATAAAAATAAATTAATTATGGAATGAGAACTTATAACCGTATTGTATCACCTAAGCACAGCAGGTGAA
ATATGCCTCCGCTCAGAAACATTGAGATGAGAAAGTAAAACCAAGTGAAGTTTGAGTTTACCATATTTGC
CTCTCATAGTATCTTGCAGACAGAGGTGTGGCTTTAGGAAAGTGAAAATGCTATCAAGTCAGAGATGCTT
GCCTAAAGTGTTATTAGTGAATGCTGGAAGCCAGAACCAACCATGTGACAGAAGAAAAGGGACATCATTA
CGTAAATTAGTATTTCTCTCTTAAATACCTTGGTTCAACCAAGCCACTGGGGAGCAGAAGGGAGGCGGTG
GCCTTTCTGTGTGCTCCCTGGAGAAGGTTCCTGTGCTCATAATCCCACTGTG
Notes:The probe template was PCR amplified from IMAGE:572121 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:572121 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000169 same experiment
 EMAGE:29318 same embryo
 EMAGE:31935 same embryo
 EMAGE:31004 same embryo
 EMAGE:31045 same embryo
 EMAGE:31940 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS