Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31055

Msn ( MGI:97167)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31055 EMAGE:31055 EMAGE:31055 EMAGE:31055 EMAGE:31055
euxassay_009365_01 euxassay_009365_02 euxassay_009365_03 euxassay_009365_04 euxassay_009365_05
EMAGE:31055 EMAGE:31055 EMAGE:31055 EMAGE:31055 EMAGE:31055
euxassay_009365_06 euxassay_009365_07 euxassay_009365_08 euxassay_009365_09 euxassay_009365_10
EMAGE:31055 EMAGE:31055 EMAGE:31055 EMAGE:31055 EMAGE:31055
euxassay_009365_11 euxassay_009365_12 euxassay_009365_13 euxassay_009365_14 euxassay_009365_15
EMAGE:31055 EMAGE:31055 EMAGE:31055 EMAGE:31055 EMAGE:31055
euxassay_009365_16 euxassay_009365_17 euxassay_009365_18 euxassay_009365_19 euxassay_009365_20
EMAGE:31055 EMAGE:31055 EMAGE:31055 EMAGE:31055
euxassay_009365_21 euxassay_009365_22 euxassay_009365_23 euxassay_009365_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
reproductive system
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
body cavity or lining
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
sensory organ system
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24
mesenchyme
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 19 20 21 22 23 24
organ system
moderate moderate
othermoderate expression: see section 14
alimentary system
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
urinary system
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
nervous system
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
integumental system
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vertebral axis musculature
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
cardiovascular system
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24
gland
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
respiratory system
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 21 22 23 24
tail
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
limb
moderate moderate
othermoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36650
Entity Detected:Msn, ( MGI:97167)
Sequence:sense strand is shown

>T36650
GACTTTGTGTTCTATGCTCCCCGGCTTCGGATTAACAAGCGGATCTTGGCCCTGTGCATGGGAAATCATG
AGCTGTACATGCGTCGGCGCAAGCCTGACACCATTGAGGTGCAGCAGATGAAGGCCCAGGCTCGGGAAGA
GAAGCACCAGAAGCAGATGGAGCGTGCTCTCCTGGAAAATGAGAAGAAGAAGCGTGACGTGGCTGAGAAA
GAGAAGGAGAAGATTGAGCGGGAGAAGGAAGAGCTGATGGAGAAGCTGAAGCAGATTGAGGAGCAGACTA
AGAAGGCTCAGCAAGAGCTGGAAGAGCAGACCCGCAGCCCCTTAGAACTTGAGCAGGAACGGAAGCGTGC
CCAGAGTGAGGCCGAAAAGCTAGCCAAGGAGCGTCAAGAAGCTGAAGAAGCCAAAGAGGCCCTGCTGCAG
GCTTCTCGGGACCAGAAGAAGACCCAGGAACAGCTGGCTTCAGAAATGGCAGAGCTGACGGCACGGATCT
CCCAGTTGGAAATGGCTCGAAAGAAGAAGGAAAGTGAGGCTGTGGAATGGCAGCAAAAGGCCCAGATGGT
ACAGGAAGACTTGGAGAAGACTCGTGCTGAGCTGAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74397. Forward Primer - name:074397_F_cDNA_Msn, sequence:GACTTTGTGTTCTATGCTCCCC; Reverse Primer - name:074397_N_SP6_cDNA_Msn, sequence:TTCAGCTCAGCACGAGTCTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009365 same experiment
 EMAGE:29429 same embryo
 EMAGE:31537 same embryo
 EMAGE:32040 same embryo
 EMAGE:30468 same embryo
 EMAGE:31578 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS