Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32040

Hecw1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 ( MGI:2444115)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32040 EMAGE:32040 EMAGE:32040 EMAGE:32040 EMAGE:32040
euxassay_009392_01 euxassay_009392_02 euxassay_009392_03 euxassay_009392_04 euxassay_009392_05
EMAGE:32040 EMAGE:32040 EMAGE:32040 EMAGE:32040 EMAGE:32040
euxassay_009392_06 euxassay_009392_07 euxassay_009392_08 euxassay_009392_09 euxassay_009392_10
EMAGE:32040 EMAGE:32040 EMAGE:32040 EMAGE:32040 EMAGE:32040
euxassay_009392_11 euxassay_009392_12 euxassay_009392_13 euxassay_009392_14 euxassay_009392_15
EMAGE:32040 EMAGE:32040 EMAGE:32040 EMAGE:32040 EMAGE:32040
euxassay_009392_16 euxassay_009392_17 euxassay_009392_18 euxassay_009392_19 euxassay_009392_20
EMAGE:32040 EMAGE:32040 EMAGE:32040 EMAGE:32040
euxassay_009392_21 euxassay_009392_22 euxassay_009392_23 euxassay_009392_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
weak weak
regionalweak expression: see section 21
vagus x ganglion
weak weak
regionalweak expression: see section 08 18
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 17 18 19 20 21 22
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 17 18 19
cerebral cortex
moderate moderate
regionalmoderate expression: see section 02
spinal cord
weak weak
regionalweak expression: see section 11 12 13 14 15 16
brain
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 08 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36675
Entity Detected:Hecw1, HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 ( MGI:2444115)
Sequence:sense strand is shown

>T36675
CAAACAGGAAAAAGGACAGGACATATGACATTTATTCCAATCGATGAATTTTGTTTAATCTATTCTCACG
CACACATAGTCCAAATAAATCTCATGGCTTTTGTTGCAGCCAAGTTTATTTACGTGATAGGCCAAACTTT
TGCTTCTTTTTAGCTTTGATACTTTTCTCATTCTTTTTTTTTTCCTTTCCTTTCCTTTTTTTAAATCATG
GTGTTCAAATTCTGTCACATCTGATGTTCACAGACACCACATACAAAGCTGCAGAGCACGATGGTGCTTG
TTAAGGATCACGGGCAATATAAACTTTTCCTTCATCCTTAGTGATTCTTCAAAGGCACGCTGACTTGTGT
CCACAAAAAAAAAATCCATTTTTTTAAAGCATTCAGCAAAATATTTAAGAAAATGTGTTTTTAGAAAAAC
AATCACAGGCTCCACAGACAGCCTGGCATCTTAAGTACATTTGAGATAAATTTAACCATAATGGTCATTT
GCTATTTTTTGTAACCATGTTATCCATGTTGTCTGAAATACGACATAAATGAAAGTGGTTTTTCTTCACT
GGGAAAAAAAAAAGCTAAAGAGACCCAACTATTTAAATATTCATTGTTGTAGTCAACATATTAAAATAAA
AGAACAAGTCTGAGAATGTAAAGCTAACTTAGGATGAAGCCATGCCTCGTGGCTCAGTACAGCAGTGTGT
TTTGTTCCTGCACATTAAAATATTTTCTTAGTAAAAATTATTCACAATGCCAAGACACTCTGTGTTCCTG
TGTTTCTTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 84061. Forward Primer - name:084061_F_cDNA_Nedl1, sequence:CAAACAGGAAAAAGGACAGGAC; Reverse Primer - name:084061_N_SP6_cDNA_Nedl1, sequence:CAAAGAAACACAGGAACACAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009392 same experiment
 EMAGE:29429 same embryo
 EMAGE:31537 same embryo
 EMAGE:31055 same embryo
 EMAGE:30468 same embryo
 EMAGE:31578 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS