Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31578

Ndst3 ( MGI:1932544)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31578 EMAGE:31578 EMAGE:31578 EMAGE:31578 EMAGE:31578
euxassay_009403_01 euxassay_009403_02 euxassay_009403_03 euxassay_009403_04 euxassay_009403_05
EMAGE:31578 EMAGE:31578 EMAGE:31578 EMAGE:31578 EMAGE:31578
euxassay_009403_06 euxassay_009403_07 euxassay_009403_08 euxassay_009403_09 euxassay_009403_10
EMAGE:31578 EMAGE:31578 EMAGE:31578 EMAGE:31578 EMAGE:31578
euxassay_009403_11 euxassay_009403_12 euxassay_009403_13 euxassay_009403_14 euxassay_009403_15
EMAGE:31578 EMAGE:31578 EMAGE:31578 EMAGE:31578 EMAGE:31578
euxassay_009403_16 euxassay_009403_17 euxassay_009403_18 euxassay_009403_19 euxassay_009403_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 02 03 04 05
midbrain mantle layer
strong strong
regionalstrong expression: see section 15 moderate expression: see section 14 16 weak expression: see section 13
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 12 13 14 weak expression: see section 15 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36672
Entity Detected:Ndst3, ( MGI:1932544)
Sequence:sense strand is shown

>T36672
CCTTGGTCAAGACATCATTACGATGCTAGAATCCATCCGGTTCCATTATCACACTGAAATCGCTCCTGGT
AAAGGAGATCTTCCGGCACTTACAGACAATGTGAAGGGCAAATATGTTCTCATTATATATGAGAATATTC
TAAAGTATATAAACATGGACTCTTGGAATAGAAGCCTTTTAGATAAATACTGTATAGAGTATGGTGTGGG
TATCATTGGATTCCATAAAACCAGTGAGAAAAATCTACAGAGCTTTCAGGTCAGGGGCTTCCCCTTTTCC
ATAAGTGGAAACCTGGCAGTAAAAGATTGCTGCATTAATCCTCACTCCCCACTCCTTCGTGTGACCAAAT
CATCCAAGCTGGACAGAGGTTCTCTACCTGGAACTGACTGGACAGTTTTTCAGATTAACCACTCCACCTA
CCAGCCAGTAATATTTGCCAAAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 66300. Forward Primer - name:066300_F_cDNA_Ndst3, sequence:CCTTGGTCAAGACATCATTACG; Reverse Primer - name:066300_N_SP6_cDNA_Ndst3, sequence:CTTTGGCAAATATTACTGGCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009403 same experiment
 EMAGE:29429 same embryo
 EMAGE:31537 same embryo
 EMAGE:31055 same embryo
 EMAGE:32040 same embryo
 EMAGE:30468 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS