Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31357

Mgst3 microsomal glutathione S-transferase 3 ( MGI:1913697)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31357 EMAGE:31357 EMAGE:31357 EMAGE:31357 EMAGE:31357
euxassay_002079_01 euxassay_002079_02 euxassay_002079_03 euxassay_002079_04 euxassay_002079_05
EMAGE:31357 EMAGE:31357 EMAGE:31357 EMAGE:31357 EMAGE:31357
euxassay_002079_06 euxassay_002079_07 euxassay_002079_08 euxassay_002079_09 euxassay_002079_10
EMAGE:31357 EMAGE:31357 EMAGE:31357 EMAGE:31357 EMAGE:31357
euxassay_002079_11 euxassay_002079_12 euxassay_002079_13 euxassay_002079_14 euxassay_002079_15
EMAGE:31357 EMAGE:31357 EMAGE:31357 EMAGE:31357 EMAGE:31357
euxassay_002079_16 euxassay_002079_17 euxassay_002079_18 euxassay_002079_19 euxassay_002079_20
EMAGE:31357
euxassay_002079_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 01 18 weak expression: see section 19 20
foregut-midgut junction
moderate moderate
regionalmoderate expression: see section 06 07 08 09
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 03 04
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 weak expression: see section 01 02
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 05 11
spinal cord
weak weak
homogeneousweak expression: see section 04 05 06 07 08 09 10 11
urethra of male
weak weak
regionalweak expression: see section 07 08
brain
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 03 04
thoracic ganglion
weak weak
regionalweak expression: see section 06 07
midgut
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10
bladder
weak weak
regionalweak expression: see section 06 07
dorsal root ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 08 09 10 11 12 13
not examined not examined
regionalnot examined expression: see section 01 18 19 20
lower jaw molar
moderate moderate
regionalmoderate expression: see section 04 14 weak expression: see section 03
upper jaw molar
moderate moderate
regionalmoderate expression: see section 04 14 weak expression: see section 03
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 13 14 15 16 17
vibrissa
moderate moderate
regionalmoderate expression: see section 02 03 16 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 10 11 12 13 14
hindgut
moderate moderate
regionalmoderate expression: see section 06 07 09
cervical ganglion
weak weak
regionalweak expression: see section 05 12
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 07 08 11
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 07 08 11
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5463
Entity Detected:Mgst3, microsomal glutathione S-transferase 3 ( MGI:1913697)
Sequence:sense strand is shown

>T5463
CGGACGCGTGGGCGAAGGTGAGCCAGAGCCAAGATGGCTGTCCTCTCTAAGGAGTATGGATTTGTGCTTC
TCACTGGTGCTGCCAGCTTTGTGATGGTGCTCCACCTAGCCATCAACGTGGGCAAAGCCCGCAAGAAGTA
CAAGGTAGAGTACCCTGTCATGTACAGCACAGATCCTGAGAACGGGCATATGTTCAACTGCATTCAGCGC
GCCCACCAGAACACGTTGGAGGTGTACCCTCCCTTCCTGTTTTTCCTAACGGTGGGAGGTGTTTACCACC
CGCGCATAGCTTCTGGCCTGGGCCTGGCCTGGATTATTGGGCGAGTCCTTTACGCATATGGCTACTACAC
AGGAGACCCTAGCAAGCGGTATCGAGGAGCCGTGGGCTCTCTTGCCCTCTTTGCCCTGATGGGCACCACC
GTGTGCTCTGCTTTCCAGCATCTCGGCTGGATCAGACCAGGCTTAGGCTACGGGTCCAGATCCTGCCACC
ACTGAGGTGTGGAGGGCCTTCCGACTCTCACTCACCTCCAGCGACTCACCCTGATTTCCAGTTGCACTGG
TTTTTTTTTTTTTTTTAATATAATAAAAACTTATCTGGCAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:5372427 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:5372427 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002079 same experiment
 EMAGE:29480 same embryo
 EMAGE:31829 same embryo
 EMAGE:31350 same embryo
 EMAGE:31348 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS