Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31645

Notch1 Notch gene homolog 1 (Drosophila) ( MGI:97363)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31645 EMAGE:31645 EMAGE:31645 EMAGE:31645 EMAGE:31645
euxassay_008990_01 euxassay_008990_02 euxassay_008990_03 euxassay_008990_04 euxassay_008990_05
EMAGE:31645 EMAGE:31645 EMAGE:31645 EMAGE:31645 EMAGE:31645
euxassay_008990_06 euxassay_008990_07 euxassay_008990_08 euxassay_008990_09 euxassay_008990_10
EMAGE:31645 EMAGE:31645 EMAGE:31645 EMAGE:31645 EMAGE:31645
euxassay_008990_11 euxassay_008990_12 euxassay_008990_13 euxassay_008990_14 euxassay_008990_15
EMAGE:31645 EMAGE:31645 EMAGE:31645 EMAGE:31645 EMAGE:31645
euxassay_008990_16 euxassay_008990_17 euxassay_008990_18 euxassay_008990_19 euxassay_008990_20
EMAGE:31645 EMAGE:31645 EMAGE:31645 EMAGE:31645
euxassay_008990_21 euxassay_008990_22 euxassay_008990_23 euxassay_008990_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
utricle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 17 18 19
left lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
cochlea
moderate moderate
regionalmoderate expression: see section 07 08 16 18 19
skin
strong strong
regionalstrong expression: see section 20
lower jaw molar
strong strong
regionalstrong expression: see section 07
upper jaw molar
strong strong
regionalstrong expression: see section 07 moderate expression: see section 19
thymus primordium
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 08 20 21 22 23 24
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
midbrain ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 11 12 13 15 16 17 18 moderate expression: see section 09 10 19
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
cornea
strong strong
regionalstrong expression: see section 04 moderate expression: see section 05 23 24
right lung
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20 21
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12
pons ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 23 24
anterior naris epithelium
strong strong
regionalstrong expression: see section 12 13 15
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 13 14 15 16 17 18 19
external naris epithelium
strong strong
regionalstrong expression: see section 12 13 16
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 15 16 17
vomeronasal organ
strong strong
regionalstrong expression: see section 13 15
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
renal cortex
moderate moderate
regionalmoderate expression: see section 08 09 10 16 17 18 19
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35504
Entity Detected:Notch1, Notch gene homolog 1 (Drosophila) ( MGI:97363)
Sequence:sense strand is shown

>T35504
TAAACAGAGATGTGGGATGCAGGACCCCAGCTTCCGTTCCCAAGCCCTGTTGGGAGTCCTTTCCAGTGCT
TCAGGATGCTGGGGCGACCAAAGGAGCCTTTTAAAAAATGTTTTTATACAAAATAAGAGGACAAGAATTT
CCATTTTTTTTTTTAGTATTTATTTATGTACTTTTATTTTCCACAGAAACACTGCCTTTTTATTTATATG
TATTGTTTTCTATGGCACTAGGGAAAAACATATCTGTTCCAAGAAAATAAACTAGTTCTCAGAGCCTTGA
TTTTCCTGGTCAGGGTGAAGTTCCCTGTGTGTCTGTAAAATATGAACAAGGATTCATGATTTGTAAATGC
TGTTTATTTATTGATTGCTTCTTTCCAAAATCGAAAAGAAAGAAAAAAGAACGTGACAGGAGAAGGGAAG
CTGGAAACTGCCATGGCCAGAATTGCCCCTCCCCCACACTCACTGCCCCTCCCCCCAGCGTCACCTGGGA
TTTGCAGATGTGTTTAGAAACACGCCCAGACCTTGAACCTTGGGTTCATGGATTAGTTTTGTATCTAAAA
CAGGAAACAAGTCAGATGATGTGGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 102069. Forward Primer - name:102069_F_cDNA_Notch1, sequence:TAAACAGAGATGTGGGATGCAG; Reverse Primer - name:102069_N_SP6_cDNA_Notch1, sequence:ACCACATCATCTGACTTGTTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008990 same experiment
 EMAGE:30525 same embryo
 EMAGE:31717 same embryo
 EMAGE:31653 same embryo
 EMAGE:31651 same embryo
 EMAGE:31646 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS