Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31651

Onecut2 one cut domain, family member 2 ( MGI:1891408)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31651 EMAGE:31651 EMAGE:31651 EMAGE:31651 EMAGE:31651
euxassay_008992_01 euxassay_008992_02 euxassay_008992_03 euxassay_008992_04 euxassay_008992_05
EMAGE:31651 EMAGE:31651 EMAGE:31651 EMAGE:31651 EMAGE:31651
euxassay_008992_06 euxassay_008992_07 euxassay_008992_08 euxassay_008992_09 euxassay_008992_10
EMAGE:31651 EMAGE:31651 EMAGE:31651 EMAGE:31651 EMAGE:31651
euxassay_008992_11 euxassay_008992_12 euxassay_008992_13 euxassay_008992_14 euxassay_008992_15
EMAGE:31651 EMAGE:31651 EMAGE:31651 EMAGE:31651 EMAGE:31651
euxassay_008992_16 euxassay_008992_17 euxassay_008992_18 euxassay_008992_19 euxassay_008992_20
EMAGE:31651 EMAGE:31651 EMAGE:31651 EMAGE:31651
euxassay_008992_21 euxassay_008992_22 euxassay_008992_23 euxassay_008992_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 23 24 weak expression: see section 01
ventral grey horn
moderate moderate
regionalmoderate expression: see section 07 08 11 12 weak expression: see section 09 10
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 05
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 14 15 16 17 weak expression: see section 18
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 05
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 14 15 16 17 weak expression: see section 18
midgut
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
dorsal root ganglion
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 weak expression: see section 12
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 14 15 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35509
Entity Detected:Onecut2, one cut domain, family member 2 ( MGI:1891408)
Sequence:sense strand is shown

>T35509
ATGCCTCACCAAAGACCTAGAAGGCTGCGCCATGAACCCGGAGCTGACAATGGAAAGTCTGGGCACTTTG
CACGGGCCGGTCGGCGGCGGCAGCGGCGGGGGAGGCGGCGGGGGCGGAGGGGGCGGGGGCGGGGGCCCGG
GCCATGAGCAGGAGCTGCTGGCCAGCCCCAGCCCCCACCACGCGGGCCGCGGTGCTGCCGGCTCGCTGCG
CGGCCCGCCGCCGCCAACCGCGCATCAGGAGCTGGGCACCGCAGCGGCGGCGGCAGCCGCGGCGTCGCGC
TCGGCCATGGTCACCAGTATGGCCTCGATCTTGGACGGCAGCGACTACCGACCAGAGCTCTCCATCCCGC
TACACCACGCCATGAGTATGTCCTGCGACTCGTCGCCGCCAGGCATGGGCATGAGCAACACCTACACTAC
GCTGGCGCCGCTCCAGCCGCTGCCACCCATCTCTACGGTCTCAGACAAGTTCCACCACCCGCACCCTCAC
CACCACCCTCACCACCACCATCACCACCACCATCACCATCAGCGTCTGTCCGGCAACGTCAGTGGCAGCT
TCACTCTCATGCGGGACGAGCGCGGGCTTCCGTCCATGAACAACCTTTACAGCCCTTACAAGGAGATGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96054. Forward Primer - name:096054_F_cDNA_Onecut2, sequence:ATGCCTCACCAAAGACCTAGAA; Reverse Primer - name:096054_N_SP6_cDNA_Onecut2, sequence:GCATCTCCTTGTAAGGGCTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008992 same experiment
 EMAGE:30525 same embryo
 EMAGE:31717 same embryo
 EMAGE:31653 same embryo
 EMAGE:31646 same embryo
 EMAGE:31645 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS