Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31646

Npas1 neuronal PAS domain protein 1 ( MGI:109205)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31646 EMAGE:31646 EMAGE:31646 EMAGE:31646 EMAGE:31646
euxassay_008991_01 euxassay_008991_02 euxassay_008991_03 euxassay_008991_04 euxassay_008991_05
EMAGE:31646 EMAGE:31646 EMAGE:31646 EMAGE:31646 EMAGE:31646
euxassay_008991_06 euxassay_008991_07 euxassay_008991_08 euxassay_008991_09 euxassay_008991_10
EMAGE:31646 EMAGE:31646 EMAGE:31646 EMAGE:31646 EMAGE:31646
euxassay_008991_11 euxassay_008991_12 euxassay_008991_13 euxassay_008991_14 euxassay_008991_15
EMAGE:31646 EMAGE:31646 EMAGE:31646 EMAGE:31646 EMAGE:31646
euxassay_008991_16 euxassay_008991_17 euxassay_008991_18 euxassay_008991_19 euxassay_008991_20
EMAGE:31646 EMAGE:31646 EMAGE:31646 EMAGE:31646
euxassay_008991_21 euxassay_008991_22 euxassay_008991_23 euxassay_008991_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
spinal cord lateral wall
weak weak
regionalweak expression: see section 09 11
metencephalon lateral wall
weak weak
regionalweak expression: see section 08 09 10 15 16
telencephalon mantle layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 15 16 17 18 19 20 21 22
tegmentum
weak weak
regionalweak expression: see section 10 11 15 16
medulla oblongata lateral wall
weak weak
regionalweak expression: see section 09
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35505
Entity Detected:Npas1, neuronal PAS domain protein 1 ( MGI:109205)
Sequence:sense strand is shown

>T35505
TGCTTGTGAGAGCAGAGTTAGCGACCATATGGACATGGGGCCCTCAGAGCTTGTGGGACGCAGCTGCTAC
CAGTTTGTTCATGGACAGGATGCAACCAGGATCCGCCAAAGCCATCTGGACCTGCTGGACAAAGGGCAGG
TGGTGACTGGTTACTACCGTTGGCTGCAGCGTGCGGGGGGCTTCGTGTGGCTGCAGTCTGTAGCCACTGT
GGCCGGGAACGGGAAGAGCACTGGGGAGCATCACGTGCTGTGGGTCAGTCACGTGCTCAGCAATGCTGAA
GGTAGTCAAACACCCCTGGATGCCTTCCAGCTTCCAGCTATTGTGTCTCAGGAGGAGCCATCCAGGCCAG
GCCCAGAGCCCACAGAGGAAGAGCCTCCAGTTGACGGGAAGCAGGCTGTGCCTGCGGACCAGGACAAGGA
CAAGGACCCTCAGGCCCGAGGCAAACGCATCAAAGTGGAGGCCAGCCCGAAGGAAGCTAGAGGCTCAGAG
GACAGTGGAGAAGAGGAGCTCTCGGATCCACCGGCTCCACCTCGGCCAGAATTCACTTCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 73927. Forward Primer - name:073927_F_cDNA_Npas1, sequence:TGCTTGTGAGAGCAGAGTTAGC; Reverse Primer - name:073927_N_SP6_cDNA_Npas1, sequence:AGAAGTGAATTCTGGCCGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008991 same experiment
 EMAGE:30525 same embryo
 EMAGE:31717 same embryo
 EMAGE:31653 same embryo
 EMAGE:31651 same embryo
 EMAGE:31645 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS