Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31913

Slitrk1 ( MGI:2679446)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31913 EMAGE:31913 EMAGE:31913 EMAGE:31913 EMAGE:31913
euxassay_012158_01 euxassay_012158_02 euxassay_012158_03 euxassay_012158_04 euxassay_012158_05
EMAGE:31913 EMAGE:31913 EMAGE:31913 EMAGE:31913 EMAGE:31913
euxassay_012158_06 euxassay_012158_07 euxassay_012158_08 euxassay_012158_09 euxassay_012158_10
EMAGE:31913 EMAGE:31913 EMAGE:31913 EMAGE:31913 EMAGE:31913
euxassay_012158_11 euxassay_012158_12 euxassay_012158_13 euxassay_012158_14 euxassay_012158_15
EMAGE:31913 EMAGE:31913 EMAGE:31913 EMAGE:31913 EMAGE:31913
euxassay_012158_16 euxassay_012158_17 euxassay_012158_18 euxassay_012158_19 euxassay_012158_20
EMAGE:31913 EMAGE:31913 EMAGE:31913
euxassay_012158_21 euxassay_012158_22 euxassay_012158_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 16 17
rib
moderate moderate
regionalmoderate expression: see section 04 05 06 07 17 18 19 20 21 22
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
axial skeleton
moderate moderate
regionalmoderate expression: see section 06 07 14 15 16 17
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 16 17
lower leg mesenchyme
moderate moderate
regionalmoderate expression: see section 03 04 05 22 23
pons mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
submandibular gland primordium mesenchyme
strong strong
regionalstrong expression: see section 06 07 08 09 14 15 16 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 09 10 13 14 15 16
upper arm mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 22 23
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 17 18 19 20
eye skeletal muscle
moderate moderate
regionalmoderate expression: see section 03 04 05 06 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 16
upper leg mesenchyme
moderate moderate
regionalmoderate expression: see section 03 04 05 18 19 20 21 22 23
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 16 17 18 19 20 21 22
forearm mesenchyme
moderate moderate
regionalmoderate expression: see section 01 22 23
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37054
Entity Detected:Slitrk1, ( MGI:2679446)
Sequence:sense strand is shown

>T37054
CTCCAGGGTAAAGACCTCAATGAAACCACGGAACAGGACCTGTGTCCTTTAAAAAACAGAGTGGATTCTA
GTCTCCCGGCTCCCCCTGCCCAGGAAGAAACCTTCGCTCCTGGCCCCCTGCCAACTCCTTTCAAGACAAA
TGGGCAGGATGAGCATGCTACCCCAGGGGCTGTTCCAAATGGAGGTACAAAGATCCCGGGCAACTGGCAG
CTCAAAATCAAACCCACGCCACCGATAGCAACTGGGAGCGCCAGAAACAAACCCCCAGTGCATGGCTTGC
CCTGCCCCGGGGGCTGCAGCTGTGACCACATCCCAGGCTCAGGCTTAAAGATGAACTGTAACAACCGGAA
CGTGAGCAGCTTGGCTGATTTGAAGCCTAAGCTTTCCAACGTGCAGGAGCTTTTCCTTCGAGATAACAAG
ATCCATAGCATCCGAAAATCACACTTTGTGGATTACAAGAACCTCATTCTGTTGGATCTGGGCAACAACA
ACATCGCAAACATAGAGAACAACACTTTCAAGAACCTTTTGGACCTCAGGTGGCTCTACATGGATAGTAA
CTACCTGGACACTCTGTCCCGGGAGAAATTTGCTGGGCTGCAGAACCTGGAGTATCTGAATGTGGAGTAC
AACGCGAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96214. Forward Primer - name:096214_F_cDNA_Slitrk1, sequence:CTCCAGGGTAAAGACCTCAATG; Reverse Primer - name:096214_N_SP6_cDNA_Slitrk1, sequence:ATCGCGTTGTACTCCACATT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012158 same experiment
 EMAGE:32220 same embryo
 EMAGE:32221 same embryo
 EMAGE:31917 same embryo
 EMAGE:30784 same embryo
 EMAGE:32223 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS