Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31917

Slitrk2 ( MGI:2679449)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31917 EMAGE:31917 EMAGE:31917 EMAGE:31917 EMAGE:31917
euxassay_012159_01 euxassay_012159_02 euxassay_012159_03 euxassay_012159_04 euxassay_012159_05
EMAGE:31917 EMAGE:31917 EMAGE:31917 EMAGE:31917 EMAGE:31917
euxassay_012159_06 euxassay_012159_07 euxassay_012159_08 euxassay_012159_09 euxassay_012159_10
EMAGE:31917 EMAGE:31917 EMAGE:31917 EMAGE:31917 EMAGE:31917
euxassay_012159_11 euxassay_012159_12 euxassay_012159_13 euxassay_012159_14 euxassay_012159_15
EMAGE:31917 EMAGE:31917 EMAGE:31917 EMAGE:31917 EMAGE:31917
euxassay_012159_16 euxassay_012159_17 euxassay_012159_18 euxassay_012159_19 euxassay_012159_20
EMAGE:31917 EMAGE:31917 EMAGE:31917 EMAGE:31917
euxassay_012159_21 euxassay_012159_22 euxassay_012159_23 euxassay_012159_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 15 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 17 18 20
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 14 15 16 weak expression: see section 07 08 09 10 11
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 10 11 12 13 14 15 16 18 19 20 21 22 23 24
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 14 moderate expression: see section 11 13 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37055
Entity Detected:Slitrk2, ( MGI:2679449)
Sequence:sense strand is shown

>T37055
ACACACATGTTCAAAGGCTGACCCCTACAACAAATCCTGCTCTCAACCCAACCAGAGCTCCAAAAGCCAG
CCGGCCACCCAAAATGAGAAATCGTCCGACTCCTCGAGTGACTGTGTCAAAAGACCGGCAGAGCTTTGGC
CCGATCATGGTGTACCAGACCAAGTCCCCCGTGGCCCTCACCTGTCCCAGCAGCTGTGTCTGTACTTCTC
AGAGCTCAGACAATGGTCTAAATGTGAATTGCCAAGAAAGGAAGTTCACTAACATCTCTGACCTACAGCC
CAAACCTACCAGTCCAAAGAAACTCTACCTAACAGGGAACTATCTCCAAACAGTCTATAAGAATGACCTC
TTAGAATACAGTTCACTGGATTTGTTGCATTTAGGAAACAACAGGATTGCAGTCATTCAGGAAGGTGCCT
TTACAAACCTGACCAGTTTACGAAGACTTTATCTGAATGGCAATTACCTTGAAGTGCTGTATCCTTCTAT
GTTTGATGGACTGCAGAGCTTGCAGTATCTCTATTTAGAGTATAATGTCATTAAGGAAATTAAGCCTCTG
ACCTTTGATGCTTTGATTAACCTCCAGCTCCTGTTTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 86536. Forward Primer - name:086536_F_cDNA_Slitrk2, sequence:ACACACATGTTCAAAGGCTGAC; Reverse Primer - name:086536_N_SP6_cDNA_Slitrk2, sequence:GAAACAGGAGCTGGAGGTTAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012159 same experiment
 EMAGE:31913 same embryo
 EMAGE:32220 same embryo
 EMAGE:32221 same embryo
 EMAGE:30784 same embryo
 EMAGE:32223 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS