Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:32034

Mmrn1 ( MGI:1918195)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:32034 EMAGE:32034 EMAGE:32034 EMAGE:32034 EMAGE:32034
euxassay_009396_01 euxassay_009396_02 euxassay_009396_03 euxassay_009396_04 euxassay_009396_05
EMAGE:32034 EMAGE:32034 EMAGE:32034 EMAGE:32034 EMAGE:32034
euxassay_009396_06 euxassay_009396_07 euxassay_009396_08 euxassay_009396_09 euxassay_009396_10
EMAGE:32034 EMAGE:32034 EMAGE:32034 EMAGE:32034 EMAGE:32034
euxassay_009396_11 euxassay_009396_12 euxassay_009396_13 euxassay_009396_14 euxassay_009396_15
EMAGE:32034 EMAGE:32034 EMAGE:32034 EMAGE:32034 EMAGE:32034
euxassay_009396_16 euxassay_009396_17 euxassay_009396_18 euxassay_009396_19 euxassay_009396_20
EMAGE:32034 EMAGE:32034 EMAGE:32034 EMAGE:32034
euxassay_009396_21 euxassay_009396_22 euxassay_009396_23 euxassay_009396_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
spinal cord meninges
moderate moderate
spottedmoderate expression: see section 09 15 weak expression: see section 10 11 12 13 14
mesenchyme
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon lateral wall
weak weak
spottedweak expression: see section 12
midbrain meninges
moderate moderate
spottedmoderate expression: see section 04 05 06 07 08 09 15 16 17 18 19 20 21 22 23 24 weak expression: see section 10 11 12 13 14
diencephalon meninges
moderate moderate
spottedmoderate expression: see section 04 05 06 07 08 09 15 16 17 18 19 20 21 22 23 24 weak expression: see section 10 11 13 14
left lung mesenchyme
moderate moderate
spottedmoderate expression: see section 02 03 04 05 06 07 08 09 10
telencephalon meninges
moderate moderate
spottedmoderate expression: see section 02 03 04 05 06 07 08 09 15 16 17 18 19 20 21 22 23 24 weak expression: see section 10 11 12 13 14
hindbrain meninges
moderate moderate
spottedmoderate expression: see section 04 05 06 07 08 09 15 16 17 18 19 20 21 22 23 24 weak expression: see section 10 11 12 13 14
right lung mesenchyme
moderate moderate
spottedmoderate expression: see section 10 11 15 16 17 18 19 20 21 22 23 24 weak expression: see section 12 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36636
Entity Detected:Mmrn1, ( MGI:1918195)
Sequence:sense strand is shown

>T36636
ATGCCGTAATGCTTCTACAGGTACCTGTGGACAGAATGCACTCATACCCAGGTGGACCAAAGGCTCACTG
CCAGGCAGTCAGAGTTCTCAGAAAAGTCTGACAGAACTTGTGGAATCAATAGTTGAAATTAAAACTCAAG
CCGCCCTATCTAATTTAACTTGGAATGTTGACCGATTGTTATCTGACACTCTGGCAAATATTGTCAAGCC
TCAAAAGCAGATAAAATTGCAGAAGAAACCCAACACACTTAAGAAAACGGTGAACATGACCACCATTCTG
ATAGGCCGAACACAAAGGAACACAGACACCATTATACATCCTGTAGCACAGGAACATTCCAGCTGCAGCA
GCTTCCCGTGCCAGAATGGTGGCACATGCATCAGCGGGAGATCCAACTTCATCTGCGCTTGCCGGCACCC
GTTCATGGGTGACACTTGCACCGTGAAGATCAAGGAAGATGATGCAGTAGCACCAGATTTTTCCAAAGGA
TCTTACAGATATGCTCCGATGGTGGCGTTTTTCGTATCTCACACTCACGGAATGACGGCACCTGGTCCTA
TCCTGTTCAATGATCTAAGCGTCAACTATGGGGCCTCATATAACCCAAGGACTGGCAAGTTCAGAATTCC
ATACCTTGGAGTGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 79463. Forward Primer - name:079463_F_cDNA_Mmrn1, sequence:ATGCCGTAATGCTTCTACAGGT; Reverse Primer - name:079463_N_SP6_cDNA_Mmrn1, sequence:ACACTCCAAGGTATGGAATTCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009396 same experiment
 EMAGE:31071 same embryo
 EMAGE:32033 same embryo
 EMAGE:30141 same embryo
 EMAGE:30453 same embryo
 EMAGE:31564 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS