EMAGE mouse gene expression spatial database

EMAGE:6989

Tm6sf2 transmembrane 6 superfamily member 2 ( MGI:1933210)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_002390. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_002390_01	euxassay_002390_02	euxassay_002390_03	euxassay_002390_04

euxassay_002390_05	euxassay_002390_06	euxassay_002390_07	euxassay_002390_08	euxassay_002390_09

euxassay_002390_10	euxassay_002390_11	euxassay_002390_12	euxassay_002390_13	euxassay_002390_14

euxassay_002390_15	euxassay_002390_16	euxassay_002390_17	euxassay_002390_18	euxassay_002390_19

euxassay_002390_20	euxassay_002390_21	euxassay_002390_22	euxassay_002390_23

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T1983
Entity Detected:	Tm6sf2, transmembrane 6 superfamily member 2 ( MGI:1933210)
Sequence:	sense strand is shown >T1983 TGGCCTCGAGGCCAGATTCGGCACGAGGCAACCTGCTATTGGCACTGGGTCCCCACCTGCTGGCTTTCCG CTGCCTGTGGCGGCCCGCCTTCTTCTTGCATGCAGCGCTGCCATCTTCGCCACAGGACCAAGACAAGAAG CAGCAGTGAGCATGCGCATCTCTCTGCTAAGTCATCTACCCGTGCAGCCATCATTGGCCTTCGAGGGTGG GTTAGCCACACGGACATTCGGAGAAACTGCAATCCAGGCCAGAAAGGAGCATAGGTGTTCTTGCTGCGTC ACTGTACCTCAAAAGTCACCCAGACTCTAATGCCCCCTCCTGGAATCTAGCCATCACCTCTTCCCATACA TTTAATAAAACCTTCTGATGTCTAGAACATCAACAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:718025 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:718025 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:6992 same embryo
	EMAGE:6991 same embryo
	EMAGE:6993 same embryo
	EMAGE:6987 same embryo
	EMAGE:6988 same embryo
	EMAGE:6990 same embryo
	EurExpress:euxassay_002390 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source