Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6990

Usp11 ubiquitin specific peptidase 11 ( MGI:2384312)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6990 EMAGE:6990 EMAGE:6990 EMAGE:6990 EMAGE:6990
"Pseudo-wholemount" of euxassay_002466. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002466_01 euxassay_002466_02 euxassay_002466_03 euxassay_002466_04
EMAGE:6990 EMAGE:6990 EMAGE:6990 EMAGE:6990 EMAGE:6990
euxassay_002466_05 euxassay_002466_06 euxassay_002466_07 euxassay_002466_08 euxassay_002466_09
EMAGE:6990 EMAGE:6990 EMAGE:6990 EMAGE:6990 EMAGE:6990
euxassay_002466_10 euxassay_002466_11 euxassay_002466_12 euxassay_002466_13 euxassay_002466_14
EMAGE:6990 EMAGE:6990 EMAGE:6990 EMAGE:6990 EMAGE:6990
euxassay_002466_15 euxassay_002466_16 euxassay_002466_17 euxassay_002466_18 euxassay_002466_19
EMAGE:6990 EMAGE:6990 EMAGE:6990
euxassay_002466_20 euxassay_002466_21 euxassay_002466_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6990Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6990_wholemount_strong.wlz
6990_wholemount_moderate.wlz
6990_wholemount_weak.wlz
6990_wholemount_possible.wlz
6990_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6990_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15 16 17 18 19 weak expression: see section 01 02 03 04 05 06 07 08 09 10 20 21 22 23 24 25
spinal cord
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15 weak expression: see section 10
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 15 16 17 weak expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1981
Entity Detected:Usp11, ubiquitin specific peptidase 11 ( MGI:2384312)
Sequence:sense strand is shown

>T1981
GGCCTCNAGCCAGATTCGGCACGAGGCTTCTCCAGACCTCTACAAATATGATCTCATCGCAGTTTCCAAC
CATTATGGTGGCATGCGTGATGGACACTATACAACATTTGCCTGCAACAAGGACAGTGGCCAGTGGCACT
ACTTTGATGACAATAGTGTCTCACCTGTGAATGAGAATCAGATTGAGTCCAAGGCAGCCTATGTCTTGTT
CTATCAGCGCCAAGATGTGGGTCGACGCCAGTCCCAGACTTCTTCATCTGACACTCCTGCCTCTCCTGTC
TCCAGTTCTACACCCAACTCTGACATCATGGATATCAACTAAGGAGCCCTAGAACCTACCATGGAGAAGG
AAGCCCCCTTTGCCACTCTCTCCTGTCTACCCCCTCTCTTTCCTGTGTTTATCGCCCCCCTCTGCCCCCC
CAGACATTGCAGGCTTAGTCTGTGGCTACTGTTCTCTTGTACCGCTGTATTACTCTCTCAGAAAGAAGAG
GCCCTATGCCCCTGGCAGTGTGCCCCTGCCTGTGTGTGCCCGTACAGCAGTGACTTCCTCTCCTAG
Notes:The probe template was PCR amplified from IMAGE:644898 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:644898 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6989 same embryo
 EMAGE:6992 same embryo
 EMAGE:6991 same embryo
 EMAGE:6993 same embryo
 EMAGE:6987 same embryo
 EMAGE:6988 same embryo
 EurExpress:euxassay_002466 same experiment
 MGI:4829126 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS