Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7796

Slco4c1 solute carrier organic anion transporter family, member 4C1 ( MGI:2442784)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7796 EMAGE:7796 EMAGE:7796 EMAGE:7796 EMAGE:7796
"Pseudo-wholemount" of euxassay_005243. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005243_01 euxassay_005243_02 euxassay_005243_03 euxassay_005243_04
EMAGE:7796 EMAGE:7796 EMAGE:7796 EMAGE:7796 EMAGE:7796
euxassay_005243_05 euxassay_005243_06 euxassay_005243_07 euxassay_005243_08 euxassay_005243_09
EMAGE:7796 EMAGE:7796 EMAGE:7796 EMAGE:7796 EMAGE:7796
euxassay_005243_10 euxassay_005243_11 euxassay_005243_12 euxassay_005243_13 euxassay_005243_14
EMAGE:7796 EMAGE:7796 EMAGE:7796 EMAGE:7796 EMAGE:7796
euxassay_005243_15 euxassay_005243_16 euxassay_005243_17 euxassay_005243_18 euxassay_005243_19
EMAGE:7796 EMAGE:7796 EMAGE:7796 EMAGE:7796
euxassay_005243_20 euxassay_005243_21 euxassay_005243_22 euxassay_005243_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7796Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7796_wholemount_strong.wlz
7796_wholemount_moderate.wlz
7796_wholemount_weak.wlz
7796_wholemount_possible.wlz
7796_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7796_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 20
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 16 17 moderate expression: see section 08 11 12 14 15 18
renal cortex
strong strong
spottedstrong expression: see section 03 04 05 06 07 08 12 13 14 15 16
lung
strong strong
regionalstrong expression: see section 17 18 moderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50
Entity Detected:Slco4c1, solute carrier organic anion transporter family, member 4C1 ( MGI:2442784)
Sequence:sense strand is shown

>T50
TTCCCTNCCAGGTGGAGGTCTCTGCTGTGGCCTCCAGGAATCAGAATGGGGGTTCGCAGCCTCGGGAATC
TGAGGAGCCTCAGAAGTCAACTGAGCCATCCCCGCCTTCTTCGAATCCCCCAGCTTCTGATGAGCCGCCG
GGGTCACAGCTAAGCGAGCTTGAGGAGGGACCTTGCGGGTGGAGGGGCTTTCACCCCCAGTGTCTCCAGC
GCTGCAACACCCCCCAAGGCTTTTTGCTTCACTACTGTCTCTTAGCCCTAACGCAAGGTATTGTAGTAAA
CGGCCTGGTAAACATTAGCATCTCCACCATTGAGAAGCGTTATGAAATGAAAAGCTCACTGACAGGCCTG
ATATCATCGAGCTACGACATCTCCTTTTGTGTGTTATCTCTATTTGTGTCTTTCTTTGGGGAGAGAGGAC
ACAAACCTCGCTGGCTCGCCTTTGCATCCTTTATGATAGGCCTGGGAGCGCTGGTGTTTTCCTTACCACA
CTTCTTCAGTGGAAGATATGAACTGGG
Notes:The probe template was PCR amplified from IMAGE:976408 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:976408 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7794 same embryo
 EMAGE:7793 same embryo
 EMAGE:7792 same embryo
 EMAGE:7795 same embryo
 EurExpress:euxassay_005243 same experiment
 MGI:4828298 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS