Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8863

Ttyh2 tweety homolog 2 (Drosophila) ( MGI:2157091)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8863 EMAGE:8863 EMAGE:8863 EMAGE:8863 EMAGE:8863
"Pseudo-wholemount" of euxassay_010129. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010129_01 euxassay_010129_02 euxassay_010129_03 euxassay_010129_04
EMAGE:8863 EMAGE:8863 EMAGE:8863 EMAGE:8863 EMAGE:8863
euxassay_010129_05 euxassay_010129_06 euxassay_010129_07 euxassay_010129_08 euxassay_010129_09
EMAGE:8863 EMAGE:8863 EMAGE:8863 EMAGE:8863 EMAGE:8863
euxassay_010129_10 euxassay_010129_11 euxassay_010129_12 euxassay_010129_13 euxassay_010129_14
EMAGE:8863 EMAGE:8863 EMAGE:8863 EMAGE:8863 EMAGE:8863
euxassay_010129_15 euxassay_010129_16 euxassay_010129_17 euxassay_010129_18 euxassay_010129_19
EMAGE:8863 EMAGE:8863 EMAGE:8863 EMAGE:8863 EMAGE:8863
euxassay_010129_20 euxassay_010129_21 euxassay_010129_22 euxassay_010129_23 euxassay_010129_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8863Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8863_wholemount_strong.wlz
8863_wholemount_moderate.wlz
8863_wholemount_weak.wlz
8863_wholemount_possible.wlz
8863_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8863_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 17 18 weak expression: see section 07 08 15 16
brain
moderate moderate
single cellmoderate expression: see section 01 02 05 06 07 09 10 11 21 22 23 24 weak expression: see section 03 04 08 12 13 14 15 16 17 18 19 20
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 13 14 15
diencephalon meninges
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 17 18
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 06 07 08 09 10 11 12 13 14 15 17 18 20 22 23 24
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14 15
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 05 06 07 08 09 10 11 12 13 14 15 17 18 20 22
pons ventricular layer
weak weak
regionalweak expression: see section 10 11 12 13 14 15
midbrain meninges
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 06 07 08 09 10 11 12 13 14 15 17 18 20
midbrain ventricular layer
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16 17
spinal cord
moderate moderate
single cellmoderate expression: see section 09 10 11 weak expression: see section 12 13 14 15
spinal cord meninges
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32140
Entity Detected:Ttyh2, tweety homolog 2 (Drosophila) ( MGI:2157091)
Sequence:sense strand is shown

>T32140
CGGCTCAGCGAGATCATTGCTGCCCGGGGTGACTACATCCAGACCCTGAAGTTTATGCAACAGATGGAAG
GCAATGTCGTCAGCCAGCTCTCGGGGCTGCCCGTGTGGAGGGAGGTCACCACGCAGCTGACCAAGCTGTC
CCACCAGACTGCCTATGTGGAATACTACAGGTGGCTGTCCTACCTCCTGCTTTTCATCCTTGACCTGGTC
ATCTGCCTTGTCACCTGCCTGGGACTGGCCAGGCGGTCCAAGTGTCTCCTAGCCTCCATGCTGTGCTGTG
GAATACTGACCCTGATCCTCAGCTGGGCTTTTCTGGCTGCTGATGCTGCTGCAGCAGTGGGCACCAGTGA
CTTCTGCATGGCTCCTGACATCTACATCCTGAACAACACAGGGAGCCAGATCAACTCAGAGGTGACCCGG
TACTACCTCCATTGCAGTCAGAGCCTAATCAGCCCGTTCCAGCAGTCACTGACCACCTTCCAGCGCTCAT
TGACCACCATGCAGATCCAGGTTGGAGGCCTGCTGCAGTTTGCCGTGCCCCTCTTCCCTACAGCAGAGAA
AGACCTTCTTGGCATCCAGCTTCTGCTAAACAACTCCGAGATCAGCCTGCACCAGTTGACCGCCATGTTG
GATTGCCGAGGGCTGCACAAGGACTACCTAGACGCCCTCACTGGCATCTGCTATGATGGCATTGAGGGCC
TGCTCTTCCTTGGTCTCTTCTCCCTCTTGGCTGCCCTGGCTTTCTCCACCCTGACCTGTGCCGGACCTCG
TGCCTGGAAATACTTCATCAACAGGGACAGAGATTATGATGACATCGACGACGATGACCCTTTCAACCCC
CAAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4158813), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60112. Forward Primer - name:060112_F_IRAV95_f09_Ttyh2, sequence:CGGCTCAGCGAGATCATT; Reverse Primer - name:060112_R_SP6_IRAV95_f09_Ttyh2, sequence:AGCTTGGGGGTTGAAAGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8862 same embryo
 EMAGE:8864 same embryo
 EMAGE:8861 same embryo
 EMAGE:8866 same embryo
 EMAGE:8865 same embryo
 EurExpress:euxassay_010129 same experiment
 MGI:4829004 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS