Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8864

Pisd-ps3 phosphatidylserine decarboxylase, pseudogene 3 ( MGI:1914026)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8864 EMAGE:8864 EMAGE:8864 EMAGE:8864 EMAGE:8864
"Pseudo-wholemount" of euxassay_010033. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010033_01 euxassay_010033_02 euxassay_010033_03 euxassay_010033_04
EMAGE:8864 EMAGE:8864 EMAGE:8864 EMAGE:8864 EMAGE:8864
euxassay_010033_05 euxassay_010033_06 euxassay_010033_07 euxassay_010033_08 euxassay_010033_09
EMAGE:8864 EMAGE:8864 EMAGE:8864 EMAGE:8864 EMAGE:8864
euxassay_010033_10 euxassay_010033_11 euxassay_010033_12 euxassay_010033_13 euxassay_010033_14
EMAGE:8864 EMAGE:8864 EMAGE:8864 EMAGE:8864 EMAGE:8864
euxassay_010033_15 euxassay_010033_16 euxassay_010033_17 euxassay_010033_18 euxassay_010033_19
EMAGE:8864 EMAGE:8864 EMAGE:8864 EMAGE:8864 EMAGE:8864
euxassay_010033_20 euxassay_010033_21 euxassay_010033_22 euxassay_010033_23 euxassay_010033_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8864Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8864_wholemount_strong.wlz
8864_wholemount_moderate.wlz
8864_wholemount_weak.wlz
8864_wholemount_possible.wlz
8864_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8864_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 23 24
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 08 18 19
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 23
vagus x ganglion
weak weak
regionalweak expression: see section 17
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 07 08 18 19 20
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 22
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 10 17 18
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 08 09 10 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31821
Entity Detected:Pisd-ps3, phosphatidylserine decarboxylase, pseudogene 3 ( MGI:1914026)
Sequence:sense strand is shown

>T31821
GTCCATGGGTGCAGAGGAGAGGTTCTGGGTCTCTCAGGACCTAGGCCCCTTTTCAGAGTATGGGTGGGTG
TGATTTGACCCCAAAGTCACTTTCAGGGGTGTTTTAAATTTTTGTACAAGCCAGAGCCTCCCACCCCTAA
CTCCTGGCTGTGTACTACCACACCCTCTAGCTGCGCCCCCCACCCGTCACAGGGCTCTCTCACTGTGCAC
AGGGTGAGGTGCCTGCTGGGCAGAGACTGTGGATCCACTGTCTTCCTAGAGCAGGCCACATGGCCTTCAT
AACTGCTTTCTGCTCCCAAATTTCACCCGTCTGCATGCTGAAAAAGTAAAATCATTTATATAATGCTGGA
TGTGTTGTCCTGGGCTCTGTCAGTGTCTTCTGAGGACAATGACTAATGATGTATGTAGACCTTTGTAGGC
TCTAAGAAGCTGGCTGAATCCTTTTGCTGGTAGGCAAGACCAATTAATTACTGGCTTGTCTGGTAGAGTC
TGGAGTGAAAGGGCAGGTTGAGGCCTTGCCCTGCAGAAGTAGGGGACATGCTGCTATTGGTCTAGGGACT
GTGTTGGAAGCAGAGGGTATGGAGGTCAGTACCTAGAAAACAGGTATGCAGGCCATGGGGAACCCAGTGG
TAGGGACAAGACCAGAGTTCATGTCGATCTTGGGAATGCCATGAATTTCCCCTGCAGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6485174), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59442. Forward Primer - name:059442_F_IRAV99_f09_MGC65558, sequence:GTCCATGGGTGCAGAGGA; Reverse Primer - name:059442_R_SP6_IRAV99_f09_MGC65558, sequence:TCCTGCAGGGGAAATTCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8862 same embryo
 EMAGE:8861 same embryo
 EMAGE:8866 same embryo
 EMAGE:8863 same embryo
 EMAGE:8865 same embryo
 EurExpress:euxassay_010033 same experiment
 MGI:4827220 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS