Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8883

Tmem63b transmembrane protein 63b ( MGI:2387609)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8883 EMAGE:8883 EMAGE:8883 EMAGE:8883 EMAGE:8883
"Pseudo-wholemount" of euxassay_010098. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010098_01 euxassay_010098_02 euxassay_010098_03 euxassay_010098_04
EMAGE:8883 EMAGE:8883 EMAGE:8883 EMAGE:8883 EMAGE:8883
euxassay_010098_05 euxassay_010098_06 euxassay_010098_07 euxassay_010098_08 euxassay_010098_09
EMAGE:8883 EMAGE:8883 EMAGE:8883 EMAGE:8883 EMAGE:8883
euxassay_010098_10 euxassay_010098_11 euxassay_010098_12 euxassay_010098_13 euxassay_010098_14
EMAGE:8883 EMAGE:8883 EMAGE:8883 EMAGE:8883 EMAGE:8883
euxassay_010098_15 euxassay_010098_16 euxassay_010098_17 euxassay_010098_18 euxassay_010098_19
EMAGE:8883 EMAGE:8883 EMAGE:8883 EMAGE:8883 EMAGE:8883
euxassay_010098_20 euxassay_010098_21 euxassay_010098_22 euxassay_010098_23 euxassay_010098_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8883Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8883_wholemount_strong.wlz
8883_wholemount_moderate.wlz
8883_wholemount_weak.wlz
8883_wholemount_possible.wlz
8883_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8883_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 weak expression: see section 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 19 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 17 18 19 20 21 22 weak expression: see section 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17 18 weak expression: see section 08 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 17
spinal cord
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 08 09 15
cervical ganglion
weak weak
regionalweak expression: see section 08 16
thoracic ganglion
weak weak
regionalweak expression: see section 13 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 15 16 17 18
neural retina
weak weak
regionalweak expression: see section 02 03 04 23 24
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 10 11 12 15 16 17
mandible
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 06 07 08 09 10 15 18 19
maxilla
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 08 09 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32137
Entity Detected:Tmem63b, transmembrane protein 63b ( MGI:2387609)
Sequence:sense strand is shown

>T32137
GCTGTGTGGTTCGAGGCTGCGAGCAGGTGGAGGCCATTGAGTACTACACAAAGCTGGAGCAGAGGCTGAA
GGAAGACTACAGGCGGGAGAAGGAGAAAGTGAACGAGAAACCTCTGGGCATGGCCTTTGTCACCTTCCAC
AATGAGACCATCACAGCCATCATCCTAAAGGACTTCAACGTGTGCAAATGCCAGGGCTGTACCTGCCGCG
GGGAGCCGAGAGCCTCCTCCTGCAGCGAAGCACTGCATATCTCCAACTGGACCGTGACCTACGCCCCTGA
CCCTCAGAACATCTATTGGGAACACCTCTCCATCCGAGGCTTCATCTGGTGGCTGCGCTGCCTGGTCATC
AATGTGGTCCTCTTCATTCTGCTCTTCTTCCTCACCACCCCGGCCATCATCATCACCACCATGGACAAGT
TCAACGTCACCAAGCCTGTGGAGTACCTCAACAACCCGATCATCACCCAGTTCTTCCCTACGCTACTGCT
GTGGTGCTTCTCGGCCCTGCTCCCCACCATTGTCTACTACTCCGCCTTCTTCGAAGCACACTGGACGCGC
TCCGGGGAGAACAGGACGACCATGCACAAGTGCTACACCTTTCTCATCTTCATGGTGCTGCTTCTGCCCT
CGCTGGGGCTGAGCAGCCTAGACCTCTTCTTCCGCTGGCTCTTTGACAAGAAATTCCTGGCTGAAGCAGC
TATTCGGTTTGAGTGTGTGTTCCTGCCCGACAACGGCGCTTTCTTCGTGAACTACGTCATTGCCTCAGCC
TTTATCGGTAACGCCATGGACCTGCTGCGCATCCCAGGCCTACTCATGTACATGATCCGGCTCTGCCTGG
CGCGCTCCGCCGCTGAAAGACGCAACGTGAAGCGGCATCAGGCCTACGAGTTCCAGTTTGGCGCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6529222), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59294. Forward Primer - name:059294_F_IRAV95_a04_BC026370, sequence:GCTGTGTGGTTCGAGGCT; Reverse Primer - name:059294_R_SP6_IRAV95_a04_BC026370, sequence:CTGCGCCAAACTGGAACT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8881 same embryo
 EMAGE:8882 same embryo
 EMAGE:8879 same embryo
 EMAGE:8884 same embryo
 EMAGE:8880 same embryo
 EurExpress:euxassay_010098 same experiment
 MGI:4828812 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS